Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 608

1 members and 607 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,114
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 32

Thread: Mites :(

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mites :(

    Quote Originally Posted by Bogertophis View Post
    Please forgive my skepticism, but how SAFE is Fipronil on snakes? ... This is the
    first time I've heard of anyone using Frontline spray on snakes.
    With due respect, just because it is the first time you have heard about it does not mean it is something new. There were articles dating back to the '90s in Reptiles magazine written by vets on the use of Frontline for treating mites and if you listen to the MPR episode where SBK (from the vid above) spoke on this topic you will find out that he learned about it from a vet. Off label usage of medications by vets when it comes to herps is actually pretty common.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    bcr229 (05-15-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1