Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 824

1 members and 823 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 32

Thread: Mites :(

  1. #21
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,789
    Thanks
    29,345
    Thanked 20,561 Times in 12,286 Posts

    Re: Mites :(

    Quote Originally Posted by MissterDog View Post
    If there has been reports of sudden death it makes me wonder if instructions were not followed properly? Out of curiosity do you have any links to these incidents we could look at to better access the situation?
    Your hunch on that may be correct, or mostly so. While I'm very hesitant to use any sort of pesticide for any purpose, I will say that I remember reading an account or 2 on another forum about the supposed side-effects of using PAM (Provent A Mite), but in each case, the owner had NOT followed the instructions to the letter, & had returned their snake to a slightly damp cage, whereupon the snake suffered neurological issues & nearly died. So any time the subject of mites comes up, I generally repeat the forum-accepted solutions to use PAM (along with soapy water, etc), but I always say to follow directions very carefully & that it's only for the cage, not to be used on the animal. I suspect that not everyone reads all the instructions though? I also don't doubt that some animals really ARE more susceptible to injury by PAM though. I would think that some species may be more inclined to be harmed, or maybe just the smaller, younger individuals?
    Last edited by Bogertophis; 05-11-2018 at 08:59 PM.

  2. #22
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts

    Re: Mites :(

    Quote Originally Posted by MissterDog View Post
    If there has been reports of sudden death it makes me wonder if instructions were not followed properly? Out of curiosity do you have any links to these incidents we could look at to better access the situation?
    One was from this forum recently, poor guy (or girl) lost a woma python suddenly and of unknown cause during a mite infestation using pam. I would normally consider this an unfortunate coincidence, but I have heard a few first hand accounts from keepers I have known over the years and have read online accounts of this. I will see if I can find any and I will post them when I do.

    Here is the first one I found in a quick search, I can probably find many more.

    http://www.ssnakess.com/forums/thamn...an-killer.html
    Last edited by Alter-Echo; 05-11-2018 at 10:15 PM. Reason: Added a link

  3. The Following User Says Thank You to Alter-Echo For This Useful Post:

    Bogertophis (05-11-2018)

  4. #23
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    Now, this is not pam, but its another commonly used treatment for mites, and the main ingredient is the exact same thing.

    http://thetegu.com/showthread.php?83...lling-my-snake

  5. The Following User Says Thank You to Alter-Echo For This Useful Post:

    Bogertophis (05-12-2018)

  6. #24
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,789
    Thanks
    29,345
    Thanked 20,561 Times in 12,286 Posts

    Re: Mites :(

    Quote Originally Posted by Alter-Echo View Post
    Now, this is not pam, but its another commonly used treatment for mites, and the main ingredient is the exact same thing.

    http://thetegu.com/showthread.php?83...lling-my-snake
    Oh geez, that's so sad. But they used it ON the reptiles as well as the cages... So no wonder!
    I've seen that product (NIX or RID) commonly recommended on another forum too, in the past, for getting rid of snake mites.
    Seems like it's just SO easy for the instructions (use on cage only, must dry thoroughly) to get lost in translation online.

  7. #25
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    Thing is, in the first link I posted they apparently followed instructions and it killed the snake anyway, and with many others I've spoken to in person it was the same way

  8. #26
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,789
    Thanks
    29,345
    Thanked 20,561 Times in 12,286 Posts

    Re: Mites :(

    Quote Originally Posted by Alter-Echo View Post
    Thing is, in the first link I posted they apparently followed instructions and it killed the snake anyway, and with many others I've spoken to in person it was the same way
    I don't doubt that at all. It's just like some humans cannot take certain medications, they react badly to it for whatever reason. When it comes to chemicals used on
    any living things, less is best.

  9. #27
    BPnet Veteran
    Join Date
    02-17-2016
    Posts
    337
    Thanks
    185
    Thanked 162 Times in 89 Posts
    Just found mites on one of my snakes as well. I'm moving everyone in that rack to paper towels and giving my gravid female a new container with fresh eco-earth as I don't want to risk it. Infected male is going into quarantine.

  10. #28
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mites :(

    Quote Originally Posted by Bogertophis View Post
    Please forgive my skepticism, but how SAFE is Fipronil on snakes? ... This is the
    first time I've heard of anyone using Frontline spray on snakes.
    With due respect, just because it is the first time you have heard about it does not mean it is something new. There were articles dating back to the '90s in Reptiles magazine written by vets on the use of Frontline for treating mites and if you listen to the MPR episode where SBK (from the vid above) spoke on this topic you will find out that he learned about it from a vet. Off label usage of medications by vets when it comes to herps is actually pretty common.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    bcr229 (05-15-2018)

  12. #29
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,683
    Thanks
    996
    Thanked 1,191 Times in 952 Posts
    Images: 5

    Re: Mites :(

    If you've owned snakes for any length of time, chances are you've had mites at one time or another or if you haven't you will. My process was this (and it took me the better part of a full day with my collection). I set up two tubs for soaking (one with some dawn dish soap and the other just plain water) and soaked each snake for 15 minutes in each tub. While the snakes soaked I washed all hides and water bowls in hot soapy water. The tub was cleaned with bleach and water. I then sprayed the tub down with PAM and let it dry completely. All racks were also cleaned with bleach and water and sprayed with PAM (snakes were in different room at the time). I say this about PAM (Provent-A-Mite) as I have used it successfully twice during my time owning/breeding Balls. I followed the directions to a T and made sure each and every tub was completely dry before I put the paper towels, hides and water bowls back in. I had no issues with any of my snakes. Everyone is still healthy and doing quite well. I'm not saying anyone whose snake died as a result of using PAM did or did not follow the instructions but from my personal experience, once dry it is no longer a threat to your snakes health.
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

  13. The Following User Says Thank You to PghBall For This Useful Post:

    Bogertophis (09-14-2018)

  14. #30
    Registered User
    Join Date
    08-17-2015
    Location
    Omaha, Nebraska
    Posts
    48
    Thanks
    26
    Thanked 11 Times in 9 Posts
    Images: 1

    Re: Mites :(

    Quote Originally Posted by PghBall View Post
    once dry it is no longer a threat to your snakes health.
    What about using a spray bottle to raise humidity? Wouldn't this dissolve the PAM residue and possibly harm your snakes?

  15. The Following User Says Thank You to Jaust For This Useful Post:

    Bogertophis (09-14-2018)

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1