Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 594

0 members and 594 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Banjomule (45)

» Stats

Members: 75,899
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
Welcome to our newest member, HellboyBoa
Results 1 to 6 of 6

Thread: Nidovirus

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    First, I would advocate listening to the GTPKeeper podcast and MPR podcast episodes that were exclusively devoted to this topic. That should help you get a better grip on what you are dealing with.

    Next, here is a fairly comprehensive article on nido: https://www.sciencedirect.com/scienc...42682217304130

    Less relevant but still interesting is this one on nido in shinglebacks: http://journals.plos.org/plosone/art...l.pone.0165209


    There is a lot of generalized speculation in this thread that is being thrown out as if it were fact and I would caution against that. Nido are a branch of a class of viruses that includes many known pathogens but that does not mean that any one type of nidovirus will absolutely prove infectious or pathogenic across a wide range of species. In fact, is seems from some of the limited data available that there might be strain/host specificity and also that some species may be inherently resistant while others are dramatically susceptible. However, more data on both of those is necessary before we begin hanging our hats on those ideas. As a whole, this broad class of viruses are somewhat robust but they are not the near immortal entities that has been implied. Typically, under ideal conditions this type of virus can survive 4-10 days in the environment. Increased heat, decreased humidity, and the active use of disinfectants and detergents greatly reduces the survival of viral particles.

    As far as how long you should wait before you can assume your animal is indeed clean... Someone above mentioned a retest at 90 days after the first test and I would be inclined to agree. Not because that is the know incubation time but because that is just generally good quarantine time. Personally, I would also advocate a repeat test after one year just for good measure since there does seem to be some evidence for latent carrier state in some animals.
    Last edited by asplundii; 05-10-2018 at 02:50 PM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 5 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (05-10-2018),Bellabu99 (05-25-2018),Bogertophis (05-10-2018),dr del (05-10-2018),Team Slytherin (05-25-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1