Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 836

1 members and 835 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,103
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 9 of 9

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Imported ball Pythons???

    Someone has already mentioned Outback but I would like to expound on that for a moment.

    Outback most often offers animals that have been farm-hatched from eggs that either came from wild-collected females that were captured, allowed to lay, and then released or eggs dug straight from a burrow (most often the prior). Because these animals were born in captivity - and in many cases sent over before they have even had their first shed - they are not really subject to all the parasite issues and such.

    Occasionally Outback will also offer adult WC animals (like when they get their Volta animals in), these you do need to be ready to deal with a true 'out of the wild' situation. 99% of the time Outback has already done at least a treatment for ectoparasites (ticks, mites, etc.) though I, and they, will advocate that you repeat the process in a couple weeks. You will most likely need to deal with endoparasites with the help of a vet.


    Someone mentioned getting only an unopened bag because it gives you the chance of scoring a huge new morph... I hate to be the bearer of bad news but this is simply never going to happen. The bagged babies have already been through a screening process on the farms in Africa and anything flagrant has already been picked out. You might score something minor like something in the YB complex or a Cinny or something else really subtle but even then the odds are against you, the farm guys know how to spot a morph and they are not going to let anything good slip through. In all likelihood the only thing you will get in the bags is normals. Some may be aberrant looking but they will still be normals.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (05-02-2018),Godzilla78 (05-02-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1