Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 757

0 members and 757 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 4 of 4
  1. #1
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    What happenned to Jon Courtney / Cold Blooded Addiction?

    Does anyone know if Jon is still in the business. I've tried reaching out to him several times via email and he hasn't responded. Further, I noticed his website hasn't been updated in over a year. Even his last FB post is years old. He doesn't have anything on Morphmarket, Fauna, or KS. And though I may sound like a stalker I swear I'm not. I just want to find out some information about an animal I purchased from him in "14" and the Nazca gene. I'd appreciate if anyone knows how he can be contacted.

  2. #2
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,567
    Thanks
    2,968
    Thanked 9,997 Times in 4,836 Posts
    Images: 34
    I hope he hasn't gotten out of the hobby. I bought three snakes from him a few years ago FTF and he was extremely nice with healthy animals.

  3. The Following User Says Thank You to bcr229 For This Useful Post:

    rlditmars (04-24-2018)

  4. #3
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: What happenned to Jon Courtney / Cold Blooded Addiction?

    Quote Originally Posted by bcr229 View Post
    I hope he hasn't gotten out of the hobby. I bought three snakes from him a few years ago FTF and he was extremely nice with healthy animals.
    Agreed! The animal I purchased was beautiful and the transaction/experience dealing with Jon was excellent. I saw the picture of the Mojave Super Nazca on Jon's website which looks similar in parts to the mystery animal I just hit. Since the sire was a Leopard Pin from Jon I was hoping to talk with him about that. I'm not really sure if anyone else is working with the Nazca gene in earnest.

  5. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What happenned to Jon Courtney / Cold Blooded Addiction?

    Quote Originally Posted by rlditmars View Post
    I'm not really sure if anyone else is working with the Nazca gene in earnest.
    Nazca is just another line of Paint/Sentinel/Neo so you might try tracking down people working with those and see if they can help you out
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    rlditmars (04-25-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1