Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 605

0 members and 605 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 21

Threaded View

  1. #19
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Good ombination?

    To the OP:

    People have cautioned you as to the potential for kinking with SuperCinny but no one has mentioned that with SuperButter you have the potential for bug-eyes.

    Also something to consider, with SuperButter you will very likely end up in a position where you have no clue what other genes the animal may be carrying. Is the white snake you get from a clutch a SuperButter SuperCinny Enchi Pastel GStripe Hypo or is it just a SuperButter??? Do you want to hold it back to breed it out to find out? If you want to sell it then how do you market it?


    Quote Originally Posted by Reptilius View Post
    @ AmericanTacos, what Calculator did you use, I would like to add it onto my list of Calculators I use.
    That is the calculator from MorphMarket. My only caution with it is that it does not do well with a couple of the heteroallelic supers (BlkHead/Spider... Cinny/Huffman...) but it is a lot more friendly than most of the others
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    AmericanTacos (03-30-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1