Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 655

0 members and 655 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,098
Posts: 2,572,070
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 8 of 8

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Jaguar neuro questions

    Quote Originally Posted by artgecko View Post
    There is a virus going around in carpet collections right now (can't remember the name of it) so you may want to be wary or hold off a bit and see how that goes. I've read that it is pretty widespread and has a lot of carpet people scared, as it has been found in many collections, can be symptom-free for a long time and then become fatal. I want to say it leads to chronic respiratory issues, but I could be wrong. Maybe some of the other carpet owners can chime in and remember the name of it.
    The virus is called Nidovirus. Not sure I would say it is widespread so much as now that people are much more aware it is being diagnosed and reported better. It is still early in the understanding but it seems that it may be more dangerous to chondros (which is NOT to say that carpets are safe/immune, they can and do get the disease). Again, I would refer you to MPR to learn more, they have had a few episodes on it in the last couple months. GTP Keeper Radio also did a discussion on it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    dkatz4 (03-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1