Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,995

0 members and 1,995 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,796
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Results 1 to 8 of 8
  1. #1
    BPnet Veteran dkatz4's Avatar
    Join Date
    03-13-2016
    Location
    New Jersey
    Posts
    613
    Thanks
    584
    Thanked 571 Times in 261 Posts
    Images: 23

    Jaguar neuro questions

    Simply put, do they all have it? To be perfectly honest, I’ve always Thought it ill-advised to pursue morphs that have known issues (ie spiders) but then I fell in love with a Bredli Jag that I saw at a shop so now I guess I “get it”. I’ve also heard a grading system used to describe the severity of the neuro in a particular individual, does anyone have a link to an explanation of that system? I’m not totally sold on the snake, and more importantly my wife is even less convinced, LOL, but I want to start doing research now.
    I’m going to head to the shop in question tomorrow and try and get some good pictures of the particular snake and if possible handle it a bit and see if it has a really obvious issues.
    Last edited by dkatz4; 03-14-2018 at 11:47 PM.
    1.0 Central American BI: Irwin
    0.1 Jungle, het snow BI: Gimel
    1.0 green albino, het granite Burm: Dr. Waffles
    1.0 Betta fish: Convertible
    1.1 cats: Tipitina (Tipi) and Professor Longhair (Fess)
    0.1 Egyptian baladi dog: Toasty

  2. #2
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    Not sure. I only own one carpet, an IJ/ Jungle Jag male. He does have balance issues. They were not evident when I bought him at a show, but presented during handling at home. He seems fine when in his cage, feeding, etc. But stresses during handling and then the balance issues start. He has a hard time gripping properly and judging distances, so when he is attempting to move between my arms or reach for something or "run" he almost falls quite a lot. To the point that I handle him over a table or other elevated surface and have to constantly pay attention to him (so I can't do other things while handling, like I do with my boas).

    He is still a great looking snake and display animal, just not easily handled.

    I had originally planned to avoid jags, but after multiple shows looking for a nice jungle, and coming up with nothing, he was the first really good looking carpet I found, so I fell for him.

    I've heard that they may not show neuro as badly when it is cooler (like it was in the show hall when I got him), so that may have played a role in why he didn't show symptoms at the show.

    In the end, the decision is yours, just know that the jag could show symptoms later even if it appears normal now, or if you plan to breed, that you could produce a severe case even from non-severe parents. If you want to do a lot of handling, I'd personally pass and hold out for another animal (just based on my experience). I think like with spiders, all jags have it to some extent, it just might not be enough to be noticeable. I asked on a carpet python group about my jag's symptoms and if they were "typical" or "extreme" and never got a response, so I'm not sure if my guy is average for a jag. Since he can move freely in his cage and eat without issues, I'm assuming that he is average and not an extreme case.

    Have you seen some of the hypo and stone-washed Bredii that inland reptile is producing? Those make me want another carpet.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  3. The Following User Says Thank You to artgecko For This Useful Post:

    dkatz4 (03-15-2018)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Yes, all Jags have neuro the same way all Spiders have neuro. It is part and parcel of the mutation. Some animals may have higher or lower expression of it but all of them have it.

    If you are looking for info on it try looking up some of the episodes MPR has done discussing morphs.
    Last edited by asplundii; 03-15-2018 at 08:22 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    dkatz4 (03-15-2018),Gio (03-16-2018)

  6. #4
    BPnet Veteran DennisM's Avatar
    Join Date
    07-19-2014
    Posts
    907
    Thanks
    104
    Thanked 571 Times in 379 Posts
    Images: 24
    The jag wobble varies. I currently have 8 jags in my collection and have had 4 others in the past. 11 of the 12 had only very mild symptoms. The other, a male DCI/coastal intergrade, had fairly strong symptoms as a hatchling that manifested itself at all times, not just times of excitement which is frequently reported. He was quite difficult to feed as he either couldn’t hit the prey or couldn’t locate it after he constricted it. For the first 2-3 years it would normally take 4-6 offerings before the meal would be consumed. The snake is now 10 years old and has become fairly efficient at feeding on offering #1. However, at about 4-5 years of age his equilibrium became increasingly poor. The snake is more likely to be spotted upside down than right side up these past several years. None of the other jags in my admittedly small sample have had any noticeable difference in the degree of their symptoms over the years. However, there is enough reported evidence in other collections to show that it may get worse. And sometimes get better. But I think mostly what you get wobble wise as a youngster is what you will get as an adult.

  7. The Following 3 Users Say Thank You to DennisM For This Useful Post:

    dkatz4 (03-15-2018),Gio (03-16-2018),MD_Pythons (03-15-2018)

  8. #5
    Registered User Kerol's Avatar
    Join Date
    03-22-2016
    Location
    Hungary
    Posts
    43
    Thanks
    43
    Thanked 12 Times in 11 Posts
    Images: 18
    I have 2 IJ Jags from the same cluth for a year now, and I do not see any symptoms at all. The breeder told me the parents are the same way. I had these doubts prior buying, but so far so good.
    0.1 piebald 0.1 ultramel 0.1 butter pastel 66% het ultramel
    0.1 ragdoll

  9. The Following User Says Thank You to Kerol For This Useful Post:

    dkatz4 (03-15-2018)

  10. #6
    BPnet Veteran dkatz4's Avatar
    Join Date
    03-13-2016
    Location
    New Jersey
    Posts
    613
    Thanks
    584
    Thanked 571 Times in 261 Posts
    Images: 23
    ok so
    A: today is my birthday

    B: i got to handle, not 1, but 2 carpets at the shop today (my first carpets)


    Now they were both males it turns out and, according to the shop owner did not have much potential for the kind of size i like, but still, getting to play with them for a bit was amazing, i totally get the Morelia bug now. In the pics and video, the Jag is being handled by a shop employee, i handled him as well, but he as a bit big for me to be messing with my phone, but he was awesome, and as far as i could tell was not showing any neuro behaviors. The smaller snake i am holding in the pic was a Russian line tiger and was a DREAM to handle. fun but not flighty, he seemed to say, "Dave, bro, lets just head back to your place for a minute." If only...







    https://www.facebook.com/david.j.kat...758013254/?t=0
    1.0 Central American BI: Irwin
    0.1 Jungle, het snow BI: Gimel
    1.0 green albino, het granite Burm: Dr. Waffles
    1.0 Betta fish: Convertible
    1.1 cats: Tipitina (Tipi) and Professor Longhair (Fess)
    0.1 Egyptian baladi dog: Toasty

  11. #7
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    I'd say go with your gut. It may also help to get one from a good breeder if you do have concerns (and the local ones were too pricey). Inland Reptile has some pretty affordable jungles right now and he has impeccable records and stock. He has jags too, and I'm sure would tell you if any were showing neuro, etc.

    There is a virus going around in carpet collections right now (can't remember the name of it) so you may want to be wary or hold off a bit and see how that goes. I've read that it is pretty widespread and has a lot of carpet people scared, as it has been found in many collections, can be symptom-free for a long time and then become fatal. I want to say it leads to chronic respiratory issues, but I could be wrong. Maybe some of the other carpet owners can chime in and remember the name of it.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  12. The Following 2 Users Say Thank You to artgecko For This Useful Post:

    dkatz4 (03-16-2018),Gio (03-16-2018)

  13. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Jaguar neuro questions

    Quote Originally Posted by artgecko View Post
    There is a virus going around in carpet collections right now (can't remember the name of it) so you may want to be wary or hold off a bit and see how that goes. I've read that it is pretty widespread and has a lot of carpet people scared, as it has been found in many collections, can be symptom-free for a long time and then become fatal. I want to say it leads to chronic respiratory issues, but I could be wrong. Maybe some of the other carpet owners can chime in and remember the name of it.
    The virus is called Nidovirus. Not sure I would say it is widespread so much as now that people are much more aware it is being diagnosed and reported better. It is still early in the understanding but it seems that it may be more dangerous to chondros (which is NOT to say that carpets are safe/immune, they can and do get the disease). Again, I would refer you to MPR to learn more, they have had a few episodes on it in the last couple months. GTP Keeper Radio also did a discussion on it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    dkatz4 (03-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1