Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,744

1 members and 1,743 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Results 1 to 8 of 8
  1. #1
    Registered User
    Join Date
    10-27-2017
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Dwarf ball python?

    I know this is an old thread, but I was wondering if there was any new information regarding dwarf ball pythons? I ask because I got a ball python from someone on Craigslist that is very very small. When I got it, I was told he was a month old, and he weighed 46g. He was clearly very skinny, and when she described how she fed him, I was very concerned.

    He was apparently kept with 2 other ball pythons from the same clutch, and she just put the thawed pinkies (which I have learned are WAY too small, even for hatchlings) in the tank and left them there until they were eaten, sometimes for a couple days or more! I was also told he ate half a pinkie the day before we picked him up, which I don't know how that could be possible unless he ate it and regurgitated the rest...

    Anyway, I've had him for about 5 months now, and he only weighs 75g... He eats small mice once or twice a week depending on the size of the mouse I can get from the pet store, he's a great eater on live, but won't touch rats. His new enclosure has a warm side that stays between 90 and 92 degrees, and the cool side ranges from 77-85 depending on the time of day. The humidity stays between 50-60% and goes up to about 75% when he's shedding.

    As far as I know, his tank and everything is fine, he has plenty of hides, orchid bark bedding, water stays clean and full... I don't understand how he's not putting on weight because he eats great and never regurgitates anything, and he has a big poop every time he sheds.

    Any advice? Thanks in advance!

  2. #2
    BPnet Veteran MD_Pythons's Avatar
    Join Date
    10-02-2017
    Location
    Silver Spring, MD
    Posts
    552
    Thanks
    441
    Thanked 341 Times in 205 Posts

    Re: Dwarf ball python?

    I don't think there are Dwarf Ball Pythons, it sounds like you got an underfed hatching and he's been gaining the weight back that he lost. But maybe someone more experienced can comment on that. You have a thermostat for your heat sources right? 77-85 is a big fluctuation in temps.

  3. #3
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Personally for a snake that small I'd feed every 3-4 days until it gained some weight. I'd also double check your scale to see if it's reading right, and make sure the rodent is 10% to 15% of the weight of the snake. The less you feed and the smaller the rodent size the slower the growth rate. It would be helpful to post a photo of the snake, if he is still really skinny I'd feed more than one rodent per meal until he gets his girth back.

    Some ball pythons are genetically disposed to get bigger than others but no one really calls them 'dwarf' or 'giant'. Some will get up to 5000 grams while others will never reach that size.
    Last edited by cchardwick; 03-08-2018 at 02:48 PM.


  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Dwarf ball python?

    As noted, your animal is likely just underfed. I have never heard of a dwarf ball. There are "dwarf" burms and retics but they are not true dwarves, just evolutionarily selected smaller stature animals.

    The only legitimate case of dwarfism I know of in the hobby is in western hognose


    Quote Originally Posted by cchardwick View Post
    Some ball pythons are genetically disposed to get bigger than others but no one really calls them 'dwarf' or 'giant'.
    I have actually heard of Voltas referred to as "Volta Giants" before
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Veteran MD_Pythons's Avatar
    Join Date
    10-02-2017
    Location
    Silver Spring, MD
    Posts
    552
    Thanks
    441
    Thanked 341 Times in 205 Posts

    Re: Dwarf ball python?

    Quote Originally Posted by asplundii View Post
    As noted, your animal is likely just underfed. I have never heard of a dwarf ball. There are "dwarf" burms and retics but they are not true dwarves, just evolutionarily selected smaller stature animals.

    The only legitimate case of dwarfism I know of in the hobby is in western hognose




    I have actually heard of Voltas referred to as "Volta Giants" before
    What exactly is the difference between the selected stature animals and true dwarfism?

  6. #6
    Registered User
    Join Date
    01-07-2018
    Posts
    273
    Thanks
    146
    Thanked 160 Times in 98 Posts

    Re: Dwarf ball python?

    Dwarfism in general is a result of mutations that cause skeletal defects. It's not an exact miniature version of the animal, the organism will grow in certain ways but not others. I would assume the same goes for snakes, but don't quote me on it!

    Sent from my VS995 using Tapatalk

  7. The Following User Says Thank You to Lirenn For This Useful Post:

    MD_Pythons (03-12-2018)

  8. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Dwarf ball python?

    Quote Originally Posted by MD_Pythons View Post
    What exactly is the difference between the selected stature animals and true dwarfism?

    Lirenn pretty much nailed it:
    Quote Originally Posted by Lirenn View Post
    Dwarfism in general is a result of mutations that cause skeletal defects. It's not an exact miniature version of the animal, the organism will grow in certain ways but not others. I would assume the same goes for snakes, but don't quote me on it!
    Dwarfism is a single gene mutation that impacts growth, development, and formation of the individual's body. As mentioned, dwarfs as a general rule have physical properties that differentiate them as being not just "miniature versions" of the original in question. Things like "dwarf" burms and retics would be better referred to as "pygmy" or "pygmoid". In stature/stance/build/proportion they match the original but are just scaled down in size.

    As a visual example (I find that helps some people) -- Peter Dinklage (4' 6") has dwarfism whereas the people of the Baka tribe are pygmy (average height 4' 8")
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Lirenn (03-12-2018),MD_Pythons (03-12-2018)

  10. #8
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Dwarf ball python?

    Have a Fecal done.. 5 months at the size most BP are born at would bother me. Check for Parasites.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1