» Site Navigation
0 members and 551 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: Human Chimerism...
 Originally Posted by asplundii
It is completely possible for chimeras to breed. Nick Mutton has a chimeric carpet and it produced a perfectly fine clutch, all of which hatched out.
False correlation. Just because this one woman, who is a chimera, developed an auto-immune disease does not mean that all chimeras will necessarily develop auto-immune disease. It is not an inherent condition of chimerism.
I see, so that article saying her immune system was rejecting one of her two DNA was wrong? Something else at play perhaps?
Sent from my iPhone using Tapatalk
-
-
Re: Human Chimerism...
 Originally Posted by Godzilla78
I see, so that article saying her immune system was rejecting one of her two DNA was wrong? Something else at play perhaps?
Sent from my iPhone using Tapatalk
That's not the point the previous poster was making. The point I believe they were trying to make is that in many to most cases of chimerism, the immune problem would not occur. In some ways, it has many similarities to organ transplants - with a "matching" donor, which is most likely with close relatives, the immune system will not recognize the part as foreign and will not reject it. In chimerism, the other part will naturally be that of a sibling or twin, greatly reducing the likelihood that it will not be a match and will be identified as foreign tissue vs a normal part of the body. However, as in the case of the woman in question, that is not 100%.
1.0 Pastel yellowbelly ball python -Pipsy
2.0 Checkered garter snakes - Hazama & Relius
1.0 Dumeril's boa - Bazil
-
The Following 4 Users Say Thank You to Kcl For This Useful Post:
asplundii (03-06-2018),Godzilla78 (03-05-2018),paulh (03-05-2018),Timelugia (03-06-2018)
-
Re: Human Chimerism...
 Originally Posted by Godzilla78
I see, so that article saying her immune system was rejecting one of her two DNA was wrong? Something else at play perhaps?
As Kcl noted, that was not my point at all. The cause of the auto-immune issues this woman suffers are likely for the reasons described in the article. However, what I said was that it is incorrect to say that just because it happened to this woman that means it will happen in every chimera because that is most certainly not the case. An easily proven fact when you examine other known cases of human chimerism and discover that there is no mention of every single one of them having an auto-immune disorder. Most of them were entirely ignorant of their condition because there were no indications that would lead them to think they were chimera.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Human Chimerism...
Skittles is quite the famous snake....I saw her(yes it's a her) on Brian B's vlog and then discovered she is actually on Morph Market right now as well. .....
https://www.morphmarket.com/us/c/rep...-pythons/81262
Last edited by KevinK; 03-06-2018 at 11:10 AM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|