Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 932

0 members and 932 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,145
Posts: 2,572,375
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 15

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
    Yeah... You hang around the hobby long enough and you start to hear all the origin stories. The original Toffee and Candy were brought in together in the same bag from the same shipment by an importer. The Toffee went to Craig and the Candy went to Pete (via an intermediary).

    I hear you on the "one of every morph" feeling. Been there, done that. What I have found is that once you actually get your hands on some of the morphs you are not as enthralled by them as you were when they were unattainable pictures on a screen. Find the things you are most passionate about and work on refining them.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    dakski (03-01-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1