Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,108

0 members and 1,108 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Jchipowsky (44)

» Stats

Members: 75,945
Threads: 249,143
Posts: 2,572,365
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 2 of 2
  1. #1
    Registered User Artemisia's Avatar
    Join Date
    02-11-2018
    Location
    Northeast Georgia
    Posts
    5
    Thanks
    2
    Thanked 0 Times in 0 Posts

    Bamboo Combo Coloration

    I tend to spend a lot of time on MorphMarket, a hazardous pastime for the collection-inclined. ;-) I've noticed that the Bamboo morph seems to have fairly drab coloration regardless of the other genes in play: brown and tan, sometimes with some gray hues. Dark blacks, bright yellows and oranges are largely absent. It's a shame, because I'm rather fond of the Bamboo pattern. Outside of my observations, does this sounds like an accurate observation? Do any of you know of other morphs capable of "coloring up" a Bamboo?

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Bamboo combos will basically follow the same trend as Lesser/Butter combos as their colouration is very similar. So if you see a Lesser/Butter combo you like then you will likely find the Bamboo to be similarly appealing.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1