Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,765

0 members and 1,765 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    Registered User
    Join Date
    01-07-2018
    Posts
    273
    Thanks
    146
    Thanked 160 Times in 98 Posts

    What kind of meats can snakes eat?

    I must first say that this is ONLY a point of curiosity. I am not getting any wild ideas about my girl's future feedings.

    One of my employees asked me what my snake eats and what snakes eat in general. For whatever reason, it made me wonder if snakes could eat the same kind of meats we do.

    So ... can you feed a snake a steak?

    Sent from my VS995 using Tapatalk

  2. #2
    Registered User
    Join Date
    01-07-2018
    Posts
    273
    Thanks
    146
    Thanked 160 Times in 98 Posts

    Re: What kind of meats can snakes eat?

    Dangit, just scrolled down and saw a similar question.

    Sent from my VS995 using Tapatalk

  3. #3
    BPnet Veteran Kcl's Avatar
    Join Date
    07-07-2016
    Posts
    433
    Thanks
    595
    Thanked 431 Times in 244 Posts
    Images: 27

    Re: What kind of meats can snakes eat?

    Are you asking for snakes in general or a specific species? Some are more specialized than others. Ball pythons in specific appear to be more opportunists that have had a whole lot of different mammals and birds identified in wild specimens' stomach contents. Their criteria is likely to be is it a mammal or a bird, can I catch it, and can I fit it in my mouth.

    1.0 Pastel yellowbelly ball python -Pipsy
    2.0 Checkered garter snakes - Hazama & Relius
    1.0 Dumeril's boa - Bazil

  4. #4
    Registered User
    Join Date
    10-22-2017
    Posts
    49
    Thanks
    15
    Thanked 21 Times in 16 Posts
    Snakes can eat the same meat that humans eat. Heck, feeding chicks is common among snakekeepers and everyone knows that humans eat a sinful amount of chicken.

    The issue with feeding snakes a "steak," or a cut of beef, is that it's a human-focused cut of beef; meaning that it's void of all the vitamins and nutrients contained in organs and bone matter. This is a common problem for people who want to feed their garter snakes cuts of fish fillet: they have to supplement the missing nutrients, or also feed whole prey.

    Snakes are programmed to need the entire body of the feed; brain tissue, liver, fat, bones, and all. Humans are terrible at digesting meat in general, when compared to snakes. The good thing about that is that we can beat any snake in a veggie-eating contest.
    Last edited by savora; 02-21-2018 at 10:32 AM.

  5. The Following User Says Thank You to savora For This Useful Post:

    C.Marie (02-22-2018)

  6. #5
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts
    Snake diets in the wild vary by species, but the staples are rodents, mammals, birds, reptiles and eggs.

    As for what can they eat that we can buy for ourselves at our local grocery store...meat, eggs. But should They? NO

  7. #6
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Re: What kind of meats can snakes eat?

    I've heard of people feeding whole chickens ( thawed from a supermarket) for the occasional meal ..

    I thought it a bur extravagant but then realised that whole chickens were 2 for £5 at Tesco and I'd been paying £3.50 for a damn rat !!


    Sent from my iPhone using Tapatalk Pro




  8. #7
    BPnet Veteran Kcl's Avatar
    Join Date
    07-07-2016
    Posts
    433
    Thanks
    595
    Thanked 431 Times in 244 Posts
    Images: 27

    Re: What kind of meats can snakes eat?

    I feed my ball python chicks sometimes - he got one last feeding. They're a bit cheaper than the rats from the guy I buy them from. I don't buy them for the sake of being cheaper, but because male ball pythons especially have been shown to eat birds in the wild, so I feel ok giving him one occasionally for variety.

    Grocery store meats aside from often not being a whole item, which leaves nutritional deficiencies, are often injected with saline solutions. Fine for humans, can kill a snake - it's proportionally way way more salt and they have a harder time getting rid of it. When I get fish filets from the store for my garters as part of their diet (they also get worms, pinkies, and whole silversides), it's necessary to not only choose the right type of fish, but look at the ingredients closely for dyes, salts, etc.

    OP - Check out some videos of egg-eating snakes. The egg-eating specialists will crack the egg in their throats - it's very cool looking.

    1.0 Pastel yellowbelly ball python -Pipsy
    2.0 Checkered garter snakes - Hazama & Relius
    1.0 Dumeril's boa - Bazil

  9. #8
    Registered User
    Join Date
    01-07-2018
    Posts
    273
    Thanks
    146
    Thanked 160 Times in 98 Posts

    Re: What kind of meats can snakes eat?

    So much awesome info. Thanks guys.

    Sent from my VS995 using Tapatalk

  10. #9
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: What kind of meats can snakes eat?

    Quote Originally Posted by Kcl View Post
    OP - Check out some videos of egg-eating snakes. The egg-eating specialists will crack the egg in their throats - it's very cool looking.

    I second this: very cool indeed

  11. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    As has been noted, it depends on the species.

    I have a variety of species that are specialist feeders: blackhead, bredli, hognose, grey-band, chondro, and egg-eater. All but the last can be maintained on rodent only diets if done properly but I have found that they do better when offered something closer to their typical prey items. To these ends I have moved to using ReptiLinks of one type or other for most of them, but I will occasionally cycle a rodent or a chick in now and then. For the egg-eater I just buy a pack of quail eggs at the Asian market and drop a few in every couple weeks from May-October.

    I know some keepers that have fed their blackheads chicken legs or wings from the store. Or whole fish picked up from a monger. I also know some GBK keepers that keep colonies of mourning geckos and only use those to feed their animals. I have also heard of people collecting frogs/toads for their hognose but I do not advocate doing that given the high likelihood of picking up parasites. But you might be able to get away with frog legs from the store.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1