Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 899

0 members and 899 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,145
Posts: 2,572,368
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 8 of 8

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    As has been stated, Albinos have a sensitivity to light but they do not have any problem seeing. This is a myth that comes up all the time with albinism in most every species, it originates from the fact that most Albinos people are familiar with are things like deer and horses and humans and other diurnal animals that are rendered blind over time due to the aforementioned sensitivity to light and UV exposure. Snakes that live in boxes, and that are primarily nocturnal in the wild, are not getting their corneas burned out from UV and so they can see just fine.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    CALM Pythons (02-16-2018),dakski (02-16-2018),Slicercrush (02-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1