» Site Navigation
0 members and 2,018 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
|
-
Registered User
Albino sight issues?
I've looked around online and for some reason cant find an answer to if albino ball pythons have sight issues. I have one, and when I go to pick him up he jumps almost like he didn't see me(in a way my others don't) and often hisses/strikes at me when picking him up. Always 100% docile and seems calm once lifted. Actually one of my most trustworthy once he's out! He always misses his food more often than my others, otherwise perfectly normal and healthy.(He is feed frozen or prekilled of course!) This might be a really stupid question.. but I cant find an answer for some reason.
-
-
Re: Albino sight issues?
Search for user Jay127 - thread titled - something like - Albino BP sight issues .
Sent from my iPhone using Tapatalk Pro
-
-
Re: Albino sight issues?
 Originally Posted by Ripley2
I've looked around online and for some reason cant find an answer to if albino ball pythons have sight issues. I have one, and when I go to pick him up he jumps almost like he didn't see me(in a way my others don't) and often hisses/strikes at me when picking him up. Always 100% docile and seems calm once lifted. Actually one of my most trustworthy once he's out! He always misses his food more often than my others, otherwise perfectly normal and healthy.(He is feed frozen or prekilled of course!) This might be a really stupid question.. but I cant find an answer for some reason.
I find this to be true in some sort of way in my Albino Ball Pythons. Never a prob with my Burm. They act strangely to shadows and flinch with delay as if they don't see the moving object itself but maybe its shadow. To some extent I notice this with my BEL too but not even half as much. I thought maybe i was spooking them however i wake them first and also also notice they run into things when out of the enclosure as if they never saw the wall, couch, table etc...
Over the years I've heard about site issues but was never much into Ball Pythons and never noticed this in the Python specie (Albino Burmese) Ive had.
Sent from my iPhone using Tapatalk
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)

-
-
Re: Albino sight issues?
With a quick Google I found a few write ups from threads on here and also The Reptile Report. Seems nothing is really different from one BP to another except possibly light sensitivity in Albinos... With that said none of them see well it states.
Sent from my iPhone using Tapatalk
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)

-
The Following User Says Thank You to CALM Pythons For This Useful Post:
-
Re: Albino sight issues?
I have an Albino Spider BP Female, Shayna. She doesn't really show a "spider" wobble, but I didn't know she had red eyes working against her too!
She's tame as anything, but a goofball. She will bump her head into things when holding her and then coil back, as if she didn't know she was about to hit my hand, for example.
Having said that, she doesn't seem overly sensitive to the light in her tank, or the room. She doesn't try to hide her head when I hold her, etc. But I imagine it could be impacting her vision.
So, not sure how much it affects her; having the red eyes. I only have one BP right now, and they all have their own personalities, so comparisons in a controlled environment are out for me. Shayna is very shy in general, although totally calm and inquisitive when being held. Not sure how much the shyness plays into her getting spooked by slithering into my arm, etc.
I'd be interested to see what others think.
-
The Following User Says Thank You to dakski For This Useful Post:
CALM Pythons (02-16-2018)
-
Re: Albino sight issues?
Most of , if not all , of my Albino snakes struggle to hit the food on the tongs first couple of goes ...
Sent from my iPhone using Tapatalk Pro
-
-
As has been stated, Albinos have a sensitivity to light but they do not have any problem seeing. This is a myth that comes up all the time with albinism in most every species, it originates from the fact that most Albinos people are familiar with are things like deer and horses and humans and other diurnal animals that are rendered blind over time due to the aforementioned sensitivity to light and UV exposure. Snakes that live in boxes, and that are primarily nocturnal in the wild, are not getting their corneas burned out from UV and so they can see just fine.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
CALM Pythons (02-16-2018),dakski (02-16-2018),Slicercrush (02-16-2018)
-
Albino sight issues?
Although apparently ...
" People with albinism also have an underdeveloped fovea. The fovea is the part of the retina responsible for much of visual acuity. This is usually the abnormality that most affects vision in ocular albinism and oculocutaneous albinism. Depending on the degree of foveal underdevelopment, VISION may be MILDLY or SEVERELY impaired"
Sent from my iPad using Tapatalk Pro
Last edited by Zincubus; 02-17-2018 at 09:00 AM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|