Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 754

1 members and 753 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,102
Posts: 2,572,091
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 10
  1. #1
    Registered User Virago's Avatar
    Join Date
    01-15-2018
    Location
    Detroit
    Posts
    83
    Thanks
    131
    Thanked 44 Times in 29 Posts

    questions on selling/giving away hatchlings

    Hello everyone, first I am not a breeder and only recently started the bp hobby. I have a Mojave Fire female and am considering breeding her in the future to hopefully get a Blue eyed Lucy.

    My question is how hard is it to sell or give away babies on Craigslist or Facebook or even other breeders?
    Should i just save my pennies for a Blue eyed or is the experience of breeding my own snake worth it?
    An if i keep them, how time consuming is it to care for a bunch of hatchlings?

    Again i don't got a ton of experience and am just wondering an looking for opinions and advice from experienced breeders and/or keepers. Thanks!

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Selling snakes can be as hard or as easy as you want it to be, all depends on how much time and effort you are willing to put in to it.

    If you are just wanting a BluEL and nothing else then it might make more sense to just buy the BluEL. But if you are wanting to tackle the whole breeding experience then be ready to undertake all that involves -- The time to feed the animals up to size, the pairing, the monitoring the female, removing the eggs, incubating them (do you have an incubator??), hatching them out, setting them up, getting them feeding, holding on to them until you finally place them all (could be a couple weeks, could be a couple months, could be a couple years...)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Eric Alan (01-30-2018)

  4. #3
    BPnet Veteran ElliotNess's Avatar
    Join Date
    05-28-2014
    Posts
    690
    Thanks
    2
    Thanked 426 Times in 263 Posts
    Why not just purchase one instead of just giving away babies to people who most likely wont take care of them. Would you breed litters of german shepherds until you get a blue eyed boy then just give them to random people...
    "Passion Breeds Quality, Quality Breeds Desire" - Tim

  5. The Following User Says Thank You to ElliotNess For This Useful Post:

    tttaylorrr (01-30-2018)

  6. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    You will likely have people that want free stuff, question is are they gonna get it free to resell it or as a cheap disposable pet for which they won't even provide for?

    If you breed animals your responsibility will be to get then we'll started, having a rack where there will be individually housed, feed them 5 meals before letting them go, more if you are stuck with them, because want if no one wants them in your area selling (hard to sell single genes) or giving away)

    You have to consider cost of breeding vs cost of buying what you want, I started off breeding because I wanted a Pied but at the time they were 10K each, what you are looking for reasonably priced and will cost less than breeding your own.
    Deborah Stewart


  7. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    Virago (01-30-2018)

  8. #5
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Actually you will never be 'stuck' with unwanted snakes. There are plenty of people that will pay you money for any snake you have. There are wholesalers that will take them all, just go to kingsnake.com and look at ads for snakes for sale. Under that section there are companies that advertise to buy your snakes. Send them an e-mail, I was recently in communication with one of them and they said they would buy normal hatchlings for $12 and Woma python hatchlings for $75. Sounds like they pay about 25% of retail then double the price and sell them to pet stores who then again double the price and sell them to the public. You have to have 10 snakes at a time to sell to them and they pay the shipping. It's a good way to get rid of snakes fast without selling them real cheap and crashing the market for your particular morph. BHB has been selling their excess snakes to wholesalers for over 25 years.

    You can also post them for a reasonable price on Morphmarket and Kingsnake and then wholesale them if they don't sell and you need the cash or get tired of feeding them. Or better yet, just advertise a package price on this website, a lot of people that sell at reptile shows may be interested in what you have for something new to put on their table.


  9. The Following 2 Users Say Thank You to cchardwick For This Useful Post:

    Virago (01-30-2018),WastelandExotics (01-30-2018)

  10. #6
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    A BEL can be had for $400 or sometimes less (have seen them for $350)... That is a lot less than the cost of feeding a male to breed with your snake, then buying an incubator, a baby rack, and feeders for all of the clutch until they sell. I'd just buy what you want. You would probably end up spending about 3x that much in the end. Keep in mind that you can have medical issues with breeding as well. It is not unheard of for females to become egg-bound and need surgery or for males to be injured during breeding (prolapse), etc. Tack on some vet bills to the costs above and then your BEL just got really expensive.

    I'd suggest saving up for the BEL, get a male, then years later, if you are still interested and can afford to invest in all the equipment, etc. then try breeding at that point.

    In some areas, it can be hard to move snakes. If local sales are your only option, you could be waiting for a while. I would not offer animals for free on CL. They are often gotten by people that will not care for them properly or might even abuse them.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  11. The Following 5 Users Say Thank You to artgecko For This Useful Post:

    bcr229 (01-30-2018),CALM Pythons (01-31-2018),Craiga 01453 (01-31-2018),Hannahshissyfix (01-30-2018),Virago (01-30-2018)

  12. #7
    BPnet Veteran Ladybugzcrunch's Avatar
    Join Date
    10-04-2010
    Posts
    1,000
    Thanks
    85
    Thanked 299 Times in 229 Posts
    I sold a male BEL last year for $250. $400 seems a bit high.
    Nothing

  13. The Following User Says Thank You to Ladybugzcrunch For This Useful Post:

    Virago (01-31-2018)

  14. #8
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: questions on selling/giving away hatchlings

    Quote Originally Posted by Ladybugzcrunch View Post
    I sold a male BEL last year for $250. $400 seems a bit high.
    The ones I've seen listed online are typically in the 350-400 range. There may be ones for sale for less locally or at shows, but I don't attend shows much, so base my number off of what I see online. I've personally never seen one listed for less than $350, but I haven't been shopping around for one, so I could have just missed the less expensive listings.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  15. The Following 2 Users Say Thank You to artgecko For This Useful Post:

    CALM Pythons (01-31-2018),Virago (01-31-2018)

  16. #9
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: questions on selling/giving away hatchlings

    Quote Originally Posted by artgecko View Post
    The ones I've seen listed online are typically in the 350-400 range. There may be ones for sale for less locally or at shows, but I don't attend shows much, so base my number off of what I see online. I've personally never seen one listed for less than $350, but I haven't been shopping around for one, so I could have just missed the less expensive listings.
    Thats correct.. The well known breeders don't undercut the market. Ive never seen Bob Clark, Vin Russo or Brian Sharp (all old timers lol) sell one for less than $400 plus Shipping. I have seen some go on morph market for $350 as you mentioned + shipping.
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  17. The Following User Says Thank You to CALM Pythons For This Useful Post:

    Virago (01-31-2018)

  18. #10
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts

    Re: questions on selling/giving away hatchlings

    Quote Originally Posted by CALM Pythons View Post
    Thats correct.. The well known breeders don't undercut the market. Ive never seen Bob Clark, Vin Russo or Brian Sharp (all old timers lol) sell one for less than $400 plus Shipping. I have seen some go on morph market for $350 as you mentioned + shipping.
    Yeah, you're right. The ones I've seen that were less were from MM...I think Dynasty reptiles had them listed for $350 if I remember correctly. I want to say females were more expensive, but still around $400. I know they are a larger-scale breeder, which could explain the lightly lower price (or just accounting for shipping costs).
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  19. The Following User Says Thank You to artgecko For This Useful Post:

    CALM Pythons (01-31-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1