Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,057

2 members and 2,055 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,395
Threads: 248,765
Posts: 2,570,189
Top Poster: JLC (31,651)
Welcome to our newest member, Boons
Results 1 to 9 of 9
  1. #1
    BPnet Veteran MD_Pythons's Avatar
    Join Date
    10-02-2017
    Location
    Silver Spring, MD
    Posts
    552
    Thanks
    441
    Thanked 340 Times in 205 Posts

    + Albino White Lipped Python, thoughts?


    I was browsing a White Lipped Python FB group looking for more information on those beautiful snakes and someone claimed to have a het Albino White Lipped. Naturally I checked out his page and he actually appears to have one. Here's the link to his FB page and his website. I'm not really a fan of it but I'm happy it exists, I wish more people worked with these snakes. And if everything goes to plan in a couple months I'll get one of my own.
    Last edited by Stewart_Reptiles; 01-29-2018 at 07:45 PM.

  2. The Following User Says Thank You to MD_Pythons For This Useful Post:

    Ax01 (01-29-2018)

  3. #2
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    very interesting! that's a T-positive animal tho but still very interesting. there's gotta be T-negatives out there.

    one of my dream snakes is an all-white, red eye snake w/ iridescent scales. i got my fingers crossed!
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. The Following User Says Thank You to Ax01 For This Useful Post:

    MD_Pythons (01-29-2018)

  5. #3
    BPnet Veteran MD_Pythons's Avatar
    Join Date
    10-02-2017
    Location
    Silver Spring, MD
    Posts
    552
    Thanks
    441
    Thanked 340 Times in 205 Posts

    Re: + Albino White Lipped Python, thoughts?

    Quote Originally Posted by Ax01 View Post
    very interesting! that's a T-positive animal tho but still very interesting. there's gotta be T-negatives out there.

    one of my dream snakes is an all-white, red eye snake w/ iridescent scales. i got my fingers crossed!
    I'm not too well versed in genetics, what is the difference?

  6. #4
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: + Albino White Lipped Python, thoughts?

    Quote Originally Posted by Ax01 View Post
    very interesting! that's a T-positive animal tho but still very interesting. there's gotta be T-negatives out there.

    one of my dream snakes is an all-white, red eye snake w/ iridescent scales. i got my fingers crossed!
    Quote Originally Posted by MD_Pythons View Post
    I'm not too well versed in genetics, what is the difference?
    oh geez i'm not too good w/ technical definitions. maybe someone else can chime in.

    anyway T-positive albino animals still have the enzyme tyrosinase which can still give the animal various shades of grey, browns, etc. darker pigments, but not black, mixed in w/ it's yellows, oranges and lighter colors. u can think of it as an incomplete albino. like the T-positive White Lipped Python above, it doesn't even have pink/red eyes.

    a T-negative animal is your typical albino. it doesn't have tyrosinase and have shades of yellows, oranges, etc. and has pink/red eyes. i would guess a T-negative albino White Lipped Python would be white where it was black and yellow where it had color, w/ pink/red eyes. (also fingers crossed that it would still be iridescent.)
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  7. The Following 2 Users Say Thank You to Ax01 For This Useful Post:

    MD_Pythons (01-29-2018),tttaylorrr (01-30-2018)

  8. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Ax is close in his description.

    T-Neg lacks the enzyme tyrosinase and, as such, is not capable of synthesizing melanin so the only pigmentation you will see is non-melanin based (yellows, oranges, reds).

    T-Pos have the tyrosinase enzyme and are able to synthesize melanin. In most cases the nature of the mutation in these animals is one that reduces the amount of melanin displayed such that you get lighter pigmentation of normally dark areas. However, there are some cases where you have a mutation that disrupts/destroys the ability for melanin to be properly displayed despite the fact that it is being produced. In those cases you get a phenotype that can very closely resemble a T-Neg, like Lavs and Candy/Toffee and Rainbow.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following User Says Thank You to asplundii For This Useful Post:

    Ax01 (01-30-2018)

  10. #6
    BPnet Lifer EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,218
    Thanks
    5,075
    Thanked 5,523 Times in 2,705 Posts

    Re: + Albino White Lipped Python, thoughts?

    I love the normal and black WLPs but I'm not crazy about the one in the picture
    3.0 Carpet Pythons, 1.1 Bullsnakes
    1.0 Olive Python 1.0 Scrub Python,
    1.0 BI, 0.1 BCO

  11. The Following User Says Thank You to EL-Ziggy For This Useful Post:

    Craiga 01453 (01-30-2018)

  12. #7
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,072 Times in 5,330 Posts

    Re: + Albino White Lipped Python, thoughts?

    Quote Originally Posted by EL-Ziggy View Post
    I love the normal and black WLPs but I'm not crazy about the one in the picture
    I agree 100%, but as they say, different strokes for different folks

  13. #8
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: + Albino White Lipped Python, thoughts?

    Quote Originally Posted by asplundii View Post
    Ax is close in his description.

    T-Neg lacks the enzyme tyrosinase and, as such, is not capable of synthesizing melanin so the only pigmentation you will see is non-melanin based (yellows, oranges, reds).

    T-Pos have the tyrosinase enzyme and are able to synthesize melanin. In most cases the nature of the mutation in these animals is one that reduces the amount of melanin displayed such that you get lighter pigmentation of normally dark areas. However, there are some cases where you have a mutation that disrupts/destroys the ability for melanin to be properly displayed despite the fact that it is being produced. In those cases you get a phenotype that can very closely resemble a T-Neg, like Lavs and Candy/Toffee and Rainbow.
    hey Dr. Ash, would u consider the Sunset BP a T-positive Albino? i think the Caramel Albino is already considered so, but was wondering if Sunset was another (new) line of T-positives.


    Quote Originally Posted by EL-Ziggy View Post
    I love the normal and black WLPs but I'm not crazy about the one in the picture
    i love them all. their iridescence is amazing and the joker smile is just killer! an Albino would be a bonus!!
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  14. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: + Albino White Lipped Python, thoughts?

    Quote Originally Posted by Ax01 View Post
    hey Dr. Ash, would u consider the Sunset BP a T-positive Albino? i think the Caramel Albino is already considered so, but was wondering if Sunset was another (new) line of T-positives.
    I do not see the Sunset as being a T-Pos. To my eye they seem to produce melanin just fine. It more appears that the nature of the Sunset mutation is one of improper distribution of all pigmentation in the animal

    The T-Pos morphs I recognize are: Caramel, Ultramel/Burgundy/Crider, Monarch, Banana/CG, Candy/Toffee, Rainbow, and Lav
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  15. The Following User Says Thank You to asplundii For This Useful Post:

    Ax01 (01-31-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1