» Site Navigation
0 members and 1,867 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
|
View Poll Results: Most Useful Dom/Codom Gene
- Voters
- 48. You may not vote on this poll
-
Yellowbelly
-
Enchi
-
Leopard
-
Any BEL Maker
-
Other (Please Specify)
-
Registered User
Re: The Most Useful Codominant Or Dominant Genes
Do you like the dark banana combos or the light? The yellow or the oramge?
I love the enchi and super enchi variants with Mojave or cinnamon.
IF you have the patience for recessives the leopard banana clown stuff is nuts. Seen a vid of one at 8 months and it's as bright as when it was a hatching.
-
-
From what you list, I would say Leopard or Enchi. If I were to add my own option I would throw out OD.
While I get why a lot of people like YB or BluEL group or Fire for what they do as single genes, I tend to find that once they become pervasive in your collection they are more of a hindrance. As an example, next season I have two animals that I could pair together that would offer me 324 possible outcomes one of which would be a quad superform... But two of those possible superforms are BluEL and Ivory. And in just about every case, if I make a BluEL or an Ivory I will most likely have zero idea what other genes it may be carrying so I either have to keep all of them back to prove them out or move them out as only the base superform, potentially giving out a powerhouse animal. Neither of those options appeal to me, rendering what some might call a fantastic pairing opportunity utterly worthless.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Most Useful Codominant Or Dominant Genes
Fire improves almost any combo. You can especially see the difference with adults, because Fire gets lighter and brighter with age. (Unlike Pastel, which tends to dull or brown in adulthood.) A while back, I bought a Davies line Fire female and a Butter Fire Pastel male. They both get more beautiful with every shed! Super Fires look pretty awesome too.
Sent from my SM-G935P using Tapatalk
-
The Following User Says Thank You to greco For This Useful Post:
-
I know what you mean about white snakes made with Yellowbelly. I'm going to run into the same thing with my BEL complexes. This year I'm pairing up my Bamboo with a couple female Lessers. I should get a few Blue Eyed Lucistics (BEL) that are the allelic Bamboo Lesser combo. The only problem with holding those back is if I breed them back to a Lesser I won't know if the white hatchlings are Super Lessers or Lesser Bamboos, the Lesser Bamboos being about twice as expensive. Plus if there are any other genes in the mix they are masked.
I've been considering getting a few pairs of different supers just to make pure supers, like a pair of Super Fires or Super Black Pastels. It would be neat to have a few on the tables at shows and to just keep the pairs together every season. White snakes and black snakes seem to have an appeal all their own.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
Re: The Most Useful Codominant Or Dominant Genes
 Originally Posted by asplundii
From what you list, I would say Leopard or Enchi. If I were to add my own option I would throw out OD.
While I get why a lot of people like YB or BluEL group or Fire for what they do as single genes, I tend to find that once they become pervasive in your collection they are more of a hindrance. As an example, next season I have two animals that I could pair together that would offer me 324 possible outcomes one of which would be a quad superform... But two of those possible superforms are BluEL and Ivory. And in just about every case, if I make a BluEL or an Ivory I will most likely have zero idea what other genes it may be carrying so I either have to keep all of them back to prove them out or move them out as only the base superform, potentially giving out a powerhouse animal. Neither of those options appeal to me, rendering what some might call a fantastic pairing opportunity utterly worthless.
See for me this is an example where while breeding, more genes doesnt always equal better. When I'm breeding for BELs I dont want to mess with more than a few genes and have to second guess if something is say a super phantom vs passion. I also plan most of my pairings with the intent to hopefully hit a certain combo for a hold back so I dont want a 1% chance of getting one and then over 100 other combos I dont really like. Take this year in particular, I have a waiting list for a few morphs that arent easily available so Im planning my pairings to have pretty good odds at hitting what I want for myself along with gauranteed sales of a few others before theyre even laid. It just depends on your goals. I dont try to collect every morph out there and prefer to just focus on my favorites and have customers with similar appreciation to them.
-
-
Re: The Most Useful Codominant Or Dominant Genes
 Originally Posted by HannahLou
See for me this is an example where while breeding, more genes doesnt always equal better.
The original breedings that made my animals was not done with the intent of "going for more genes", that was just a side effect. I was trying to prove out an Ivory that was suspected of carrying one gene with the hope of creating a couple nice two and three gene combos. The other genes the Ivory had were a bonus and in the end the higher multi-gene animals had greater eye appeal to me so I ended up keeping them over the two and three gene animals.
That said, my base argument stays the same even when you are dealing with low gene number animals -- If someone were to use YB throughout their collection as an enhancer gene then in very little time they would find themselves in a position where most/all of their pairings would generate Ivories, potentially to the detriment of trying to produce the other combos they would be striving for.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
The queen of all ball python morphs... spider
1.0 ♂ 2010 Spider BP 'Dante'
1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
0.0.1 2017 Aru GTP 'Ganja'
1.0 ♂ Blue Tick Coonhound 'Blue'
1.0 ♂ 2018 Basset Hound 'Cooper'
-
The Following User Says Thank You to SDA For This Useful Post:
-
pastel and enchi make everything better, and they both have cool super forms.
-
-
Re: The Most Useful Codominant Or Dominant Genes
 Originally Posted by Godzilla78
pastel and enchi make everything better, and they both have cool super forms.
I have my pastel enchi that I wanna breed just don’t know what to pair it with
Sent from my iPhone using Tapatalk
-
-
Re: The Most Useful Codominant Or Dominant Genes
 Originally Posted by Aerries
I have my pastel enchi that I wanna breed just don’t know what to pair it with
A piebald, then holdback an enchi pastel het piebald and breed it to another piebald and you have a good chance of a pastel enchi piebald! Gorgeous.
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|