Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 601

0 members and 601 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,114
Posts: 2,572,185
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 1 of 2 12 LastLast
Results 1 to 10 of 12
  1. #1
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Was originally thinking of BELs only but I have researched both Blue Eyed Lucy (Moj Moj) and Mystic Potion and love the combo. They are slightly different and only 2 possible outcomes when breeding.

    https://www.morphmarket.com/us/c/rep...-pythons/78986


    https://www.morphmarket.com/us/c/rep...pythons/110896

    Another benefit is that no normal will be produced this way. Later I might add the pinstripe in the mix for jigsaw I will keep playing with the combos and see what I can come up with but this is all in theory as of now.

    Questions,

    1) Are their any down sides to the pairing?
    2) Health issues related to the pairing?
    3) Special care needed for either morph?
    4) Anyone have experience breeding them and can share their results?

    Welcoming all advice here.

    General breeding questions....

    1) There is a lot of info on when they will be ready to breed. Is there an age when you should not continue breeding because it is a health issue for the snake?
    2) I know a lot of people incubate. What is the down side to letting the Mother snake incubate them?

    Thanks,
    Sky

  2. #2
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Are you asking about making super mojaves vs potions? Theres only a 1 gene difference if you count the super as 2 mojave. Have you seen an adult of either in person? That would probably help you pick which to buy. Or are you talking about future breeding? I have adults of most bel combos I can share.

    Sent from my SM-G920T using Tapatalk

  3. #3
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Quote Originally Posted by HannahLou View Post
    Are you asking about making super mojaves vs potions? Theres only a 1 gene difference if you count the super as 2 mojave. Have you seen an adult of either in person? That would probably help you pick which to buy. Or are you talking about future breeding? I have adults of most bel combos I can share.

    Sent from my SM-G920T using Tapatalk
    I am looking at future plans of breeding the two together 1 Super Mojave and one Mystic Potion together. I don't currently have either snake but researching pre-purchase so I know what to expect. Photos are welcome of both adults. Would you have a breeding pair of them for sale?

  4. #4
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Quote Originally Posted by Skyrivers View Post
    I am looking at future plans of breeding the two together 1 Super Mojave and one Mystic Potion together. I don't currently have either snake but researching pre-purchase so I know what to expect. Photos are welcome of both adults. Would you have a breeding pair of them for sale?
    Sales cant be posted publicly. What are your goals with breeding? That pairing wont give you anything new for hold backs.

    Sent from my SM-G920T using Tapatalk

  5. #5
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Quote Originally Posted by HannahLou View Post
    Sales cant be posted publicly. What are your goals with breeding? That pairing wont give you anything new for hold backs.

    Sent from my SM-G920T using Tapatalk
    Not looking for something new for holdbacks. I also have a pinstripe that I might throw into the mix later. Just looking for advice on the pairing.

  6. #6
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.



    First is Pastel super mojave male and second is mystic potion probable GHI female. The price is 800 for the pair. Would be two years before they mature enough to breed especially the female. Does anybody have any comments about the pair?

    Sent from my N9560 using Tapatalk
    Last edited by Skyrivers; 01-24-2018 at 04:57 PM.

  7. #7
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Later if I throw pinstripe in the mix could be even more fun.

    / % %/c #/c Traits #Traits Morph Name
    1/16 6% 32% 1/3c GHI Mystic Pastel Pinstripe 4 Lemon Blast GHI Mystic
    1/16 6% 32% 1/3c GHI Mojave Pastel Pinstripe 4 Pastave GHI Pinstripe
    1/16 6% 32% 1/3c GHI Mojave Pastel 3 Pastave GHI
    1/16 6% 32% 1/3c GHI Mystic Pinstripe 3 GHI Mystic Pinstripe
    1/16 6% 32% 1/3c GHI Mojave Pinstripe 3 Jigsaw GHI
    1/16 6% 32% 1/3c Mojave Pastel Pinstripe 3 Pastave Pinstripe
    1/16 6% 32% 1/3c GHI Mystic Pastel 3 GHI Mystic Pastel
    1/16 6% 32% 1/3c Mystic Pastel Pinstripe 3 Lemon Blast Mystic
    1/16 6% 32% 1/3c Mojave Pinstripe 2 Jigsaw
    1/16 6% 32% 1/3c GHI Mystic 2 GHI Mystic
    1/16 6% 32% 1/3c Mystic Pinstripe 2 Mystic Pinstripe
    1/16 6% 32% 1/3c GHI Mojave 2 GHI Mojave
    1/16 6% 32% 1/3c Mojave Pastel 2 Pastave
    1/16 6% 32% 1/3c Mystic Pastel 2 Mystic Pastel
    1/16 6% 32% 1/3c Mystic 1 Mystic
    1/16 6% 32% 1/3c Mojave 1 Mojave
    Share

  8. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    My only caution to you is that more and more I am seeing people breeding out MysticPotions/PurplePassions and not being able to tell the Mojave animals in the clutch from the Mystic/Phantom animals. So if you plant to breed your Potion to something in the future (like the Pinstripe you mention) you ought to make sure you do enough research so that you will be able to absolutely tell a MojavePin from a MysticPin (or whatever other combos you might have) when it comes time to sell off any offspring
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #9
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blue Eyed Lucy (Moj Moj) and Mystic Potion breeding questions.

    Quote Originally Posted by asplundii View Post
    My only caution to you is that more and more I am seeing people breeding out MysticPotions/PurplePassions and not being able to tell the Mojave animals in the clutch from the Mystic/Phantom animals. So if you plant to breed your Potion to something in the future (like the Pinstripe you mention) you ought to make sure you do enough research so that you will be able to absolutely tell a MojavePin from a MysticPin (or whatever other combos you might have) when it comes time to sell off any offspring

    I was beginning to worry about this. I wonder if banana into the mix would help them to be easier to identify? Not sure if that is possible?

  10. #10
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    I like the idea of doing just a straight pairing between a Super Mojave and a Mystic Potion. I think both would sell very well and you could easily tell which is which. And both are really awesome combos without throwing other genes in the mix. Seems like when you add other genes it just muddies an otherwise awesome Mystic Potion, I have yet to see a gene that makes it a better looking snake.

    Personally I would get a female Mystic Potion and a male Super Mojave. Not sure if I'd spread the Mystic gene around my collection, I'd keep it to the Mystic Potions. But a Super Mojave male can be mated with three or four females and used in other cool projects like a GHI Mojave, another really cool combo which would give you all GHI Mojaves and Super Mojaves. You could also buy a 'Crystal' female which is a Special Mojave. Cross that with a Super Mojave male and get all Crystals and Super Mojaves. One male and these three females and you can make a lot of really cool hatchlings, all with decent prices and a decent demand for those snakes. You could also throw in a Purple Passion (Phantom Mojave). With these pairs you would get zero normals!
    Last edited by cchardwick; 01-25-2018 at 12:15 PM.


Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1