Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,149

0 members and 1,149 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,102
Threads: 249,251
Posts: 2,572,969
Top Poster: JLC (31,651)
Welcome to our newest member, kwabenajohnson
Results 1 to 10 of 11

Hybrid View

  1. #1
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    Best racks, best lead time and best customer service around when it comes to PVC racks.

    Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.

    The last 2 will last longer and allow you to house BP until they 2000 grams.

    V15 tubs are for hatchling colubrids

    V18 Hatchling BP up to 600 grams

    V35 S BP up to 600 grams (due to height) or adult colubrids

    V35 are for adult BP up to 2000 grams and adult colubrids.
    Deborah Stewart


  2. The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Craiga 01453 (01-23-2018),Godzilla78 (03-08-2018),Roux (01-23-2018)

  3. #2
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Has anyone here used C_Cerpents rack systems?

    Quote Originally Posted by Deborah View Post
    Best racks, best lead time and best customer service around when it comes to PVC racks.

    Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.

    The last 2 will last longer and allow you to house BP until they 2000 grams.

    V15 tubs are for hatchling colubrids

    V18 Hatchling BP up to 600 grams

    V35 S BP up to 600 grams (due to height) or adult colubrids

    V35 are for adult BP up to 2000 grams and adult colubrids.
    Thinking about ordering one on the 1st.

  4. #3
    Registered User Sgt7212's Avatar
    Join Date
    02-21-2018
    Location
    NJ
    Posts
    214
    Thanks
    306
    Thanked 186 Times in 111 Posts

    Re: Has anyone here used C_Cerpents rack systems?

    Quote Originally Posted by Deborah View Post
    Best racks, best lead time and best customer service around when it comes to PVC racks.

    Combo racks will be useless very fast when it comes to growing BP as the first 5 shelves will only allow you to house BP up to 600 grams.

    The last 2 will last longer and allow you to house BP until they 2000 grams.

    V15 tubs are for hatchling colubrids

    V18 Hatchling BP up to 600 grams

    V35 S BP up to 600 grams (due to height) or adult colubrids

    V35 are for adult BP up to 2000 grams and adult colubrids.
    Thanks for this info! I’ve been thinking of getting a rack set up also and was between the Reptile Basics VE racks and the ones at C Serpents.

  5. #4
    Registered User Sgt7212's Avatar
    Join Date
    02-21-2018
    Location
    NJ
    Posts
    214
    Thanks
    306
    Thanked 186 Times in 111 Posts

    Re: Has anyone here used C_Cerpents rack systems?

    One question. What is the best way to mount the thermostat probe on the C Serpents systems? I’ve seen videos where people drill a hole in the back panel to thread the probe through. Just wondering if there is a better way to do it.

  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Has anyone here used C_Cerpents rack systems?

    Quote Originally Posted by Sgt7212 View Post
    One question. What is the best way to mount the thermostat probe on the C Serpents systems? I’ve seen videos where people drill a hole in the back panel to thread the probe through. Just wondering if there is a better way to do it.
    That was what I did, quick hit with the drill and thread the probe in. Alternately you could pull a few of the screws off the back, enough to let you slide the probe in, and then replace the screws
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Sgt7212 (03-02-2018)

  8. #6
    Account Disabled
    Join Date
    03-05-2018
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Has anyone here used C_Cerpents rack systems?

    I love C Sepents they make an amazing rack and Chris is awesome. I do love Reptile Basics just as much and their customer service and lead time is on par. I do like the looks of the Reptile Basics better and I like the cut out for the probe. You can't go wrong with C Serpents. I have racks from both companies and I have had no issues. I use them for my western's and kings. Unfortunately they are made too small (not enough tubs) for my ball python needs.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1