Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 729

0 members and 729 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 3 of 3
  1. #1
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Super fire and super black pastel

    I have a pairing this year that will have the possibility of hitting a super fire and super black pastel in the same snake. I was just wondering if anyone knows what happens in a situation like that? My guess is still a white snake but I’m not positive so figured I’d see if anyone knows. I’d love for it to be a black snake with a huge white ringer but I think I might have a better chance for that if I hit super black pastel and just fire. There is also orange dream and mojave in the mix so I have a lot of possibilities. I’m pretty excited about this pairing either way but let me know if you have any ideas what happens when you hit a double super like that.

  2. The Following User Says Thank You to rufretic For This Useful Post:

    zina10 (01-03-2018)

  3. #2
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Usually with a white snake it doesn't matter what other genes are in the mix, the snake is still white. Sometimes you can tease out a pattern using a black light or UV light. The only way to know for sure is to grow it up and prove it out. Most people with that mix would sell a white snake as a super fire, possible super black pastel possible orange dream possible Mojave. Usually the price is about the same as a super fire because you can't guarantee the other genes are in there. It's actually a good way to buy a possible multi gene snake at a low cost and take a chance that you get something neat. I actually saw a super lesser for sale and both parents were het clown, could be the worlds first super lesser clown but was selling at a price of a super lesser.


  4. The Following User Says Thank You to cchardwick For This Useful Post:

    rufretic (01-02-2018)

  5. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    A double super in this case would be a BlkEL. The tendency for SuperFires to have blotches might mean you seem some dark patches but given the behaviours of BlkPastel my inclination is to think it will push toward a higher white SuperFire.

    Honestly, the best indicator that you hit the double would be if you get a duck-billed animal.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (01-03-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1