» Site Navigation
0 members and 1,152 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,243
Posts: 2,572,935
Top Poster: JLC (31,651)
|
-
Registered User
Identifying morphs in leucistic ball pythons?
This question is intended for breeders who have experience with Blue-Eyed Leucy Balls. I'm not implying identification of, say, lesser mojave vs super lesser vs super mojave, etc, there is enough info out there for people new to the BEL complex to learn about identifying which their BEL might be if the pairing leaves room for curiosity. Not a guarantee, but anyhow this isn't THAT conversation.
I'm wondering about identifying other color or pattern mutations mixed into a BEL. This came to mind when I considered an intended future pairing of a pastel lesser to a pastel lesser pinstripe. Any BEL from this pairing could be: super lesser, pastel super lesser, pinstripe super lesser, super pastel super lesser, or super pastel pinstripe super lesser. The potentials are a bit outstanding, but the assumption is that an all white snake shows no color or pattern morph.
BUT we know that pattern morphs can sometimes be seen under a blacklight...which ones are visible under a blacklight and which aren't? And is this just adults or is this visible on hatchlings? I've also heard that specifically pastel is visible on BELs, but the only indicator I've heard of is a dorsal line. This doesn't seem intuitive to me so I question the validity of this, but maybe some of you have more experience with this problem?
I'll probably save mine to prove them out, but if I were to put them on the market, would I list them as super lesser 50% poss pastel 25% poss super pastel 50% poss pinstripe? Seems a bit too much variation considering a 2 gene super lesser is (while beautiful) just a lesser guaranteed breeder and is worth ~$300, whereas a 5 gene super pastel pinstripe super lesser is aesthetically basically the same but would breed out 100% lesser pastels and 50% pins, and would be worth I'm only guessing around $1000-$1200. I don't see a single super lesser on morphmarket with other morphs listed besides a het clown.
Essentially, locking down the identification of the genetics hidden in a BEL could be really helpful but isn't knowledge I've come across conclusively.
-
-
The only way to tell is to breed them to prove them out. I bought a super lesser pos GHI, pastel, and/or spider from garrick demeyer. Im guessing if there was a way to tell then he would know so he could charge an accurate price for the snake. However, he just said she is possibly those other 3 genes. Spider is one that is said to show a pattern under a black light. Does that mean if a BEL has the spider gene itll 100% of the time show a pattern under a black light? No one knows. Unless you spent years and years just breeding and experimenting with BELs maybe?
Last edited by MmmBanana; 12-12-2017 at 03:46 AM.
-
The Following User Says Thank You to MmmBanana For This Useful Post:
-
The BluELs, even the whitest of them, tend to retain a degree of underpatterning to them that you can pick out with a blacklight. So things like Spider and Pin and GHI and Clown and the like you should be able to pick out.
For mutations that more typically involve colour (e.g., Pastel, Enchi, OD) it tends to be easier to see these in the dirtier BluELs; SuperMojave, Potion, Crystal, etc., where they generally act to lighten up the dirtiness or add a touch of colour. If you have a clutch from the cleaner BluELs (e.g., SuperLesser) that has more than one BluEL in it you might be able to tell a difference between a "plain" BluEL versus a BluEL Pastel after a couple sheds but the difference might still be extremely subtle.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
-
The Following User Says Thank You to Roux For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|