» Site Navigation
1 members and 622 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
|
-
Tarantulas
Playing with TinyPic........
I havent posted photos since photobucket decided they want to charge for 3rd party hosting, sadly I lost a ton of photos from this site.
These are a couple of my Ts.
Whiteknee

OBT
Last edited by PitOnTheProwl; 12-05-2017 at 08:40 AM.
-
The Following 2 Users Say Thank You to PitOnTheProwl For This Useful Post:
Albert Clark (12-05-2017),C.Marie (12-05-2017)
-
Nice genic! Male or female??
Last edited by asplundii; 12-05-2017 at 08:46 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Tarantulas
 Originally Posted by asplundii
Nice genic! Male or female??
Havent tried to sex any of the 10 I have. Don't ever plan on breeding them so it wouldn't matter.
-
-
Oh sweet , sorry for your lost pictures what a pain 😢 my favorite is the pumpkin patch tarantula I think they are dwarf ?
Domestic Short Hair - Miss Becky
Russian Blue - Church
Miniature Poodle - Pierre LaPoodlePants
Banana BP - Yuri Katsuki
-
-
I would never get close to a tarantula IRL, but I can definitely admire pictures of them(just like how I feel with retics lol ).
Anyways, they're beautiful!!
1.0- Pastel het Pied- Khaa
-
The Following User Says Thank You to PythonBabes For This Useful Post:
-
Re: Tarantulas
 Originally Posted by PitOnTheProwl
Playing with TinyPic........
I havent posted photos since photobucket decided they want to charge for 3rd party hosting, sadly I lost a ton of photos from this site.
These are a couple of my Ts.
Whiteknee
OBT

I will make sure my son doesn't see these. He really wants a tarantula.
0.1 Female Normal
0.1 Lab mix

-
-
Re: Tarantulas
Cool looking arachnids Rob! Didn't know you were a spider man. Thanks for sharing.
 Stay in peace and not pieces.
-
The Following User Says Thank You to Albert Clark For This Useful Post:
PitOnTheProwl (12-05-2017)
-
Re: Tarantulas
 Originally Posted by Newbie39
I will make sure my son doesn't see these. He really wants a tarantula. 
They are cool and easy to care for. Most of mine are not handled.
-
-
Beautiful Ts! I’m currently on the search for a grammostola pulchra sling, but they are as hard to find as I expected 😂
Ball Pythons
1.0 Normal (Fírnen)
Wishlist
Pokigron Suriname BCC
Mexican Black Kingsnake
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|