» Site Navigation
2 members and 791 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.
» Today's Birthdays
» Stats
Members: 75,880
Threads: 249,078
Posts: 2,572,002
Top Poster: JLC (31,651)
|
-
Registered User
Ball Python Breeders?
I'm looking into getting a ball python soon but not sure where to get one. Everyone says to get one from a breeder and not a big pet store chain, but where? I'm in North Carolina. I've tried to look up breeders online that can ship but was not sure who to trust. Some websites hadn't been updated since like 2005. Anyone that y'all would suggest?
Thanks!
-
The Following User Says Thank You to Billingsca91 For This Useful Post:
Craiga 01453 (11-02-2017)
-
Check out morphmarket.com
-
-
Re: Ball Python Breeders?
I like the following and think they are trustworthy (I'm sure I'm missing some good ones as well):
Royal Constrictor Designs (the guy's name is Garrick DeMeyer....HUGE inventory, good reputation)......I would start here
BHB Reptiles (Brian Barczyk, BIG name in the reptile industry, good breeder, I can't think of a guy that sells more snakes...also runs a popular Youtube channel)
Bob Clark (longtime breeder in the industry, known for quality Reticulated pythons but he produces a lot of good BP's as well)....occasionally has KILLER deals on auctions on his Facebook page.
MorphMarket or Kingsnake.com are a collection of breeders (most are good, some are not). Think of it as a Craigslist for reptiles.....I would encourage you to go with what you were told and avoid large pet store type shops and herp farms.
Don't overlook the classifieds section on this site however. There are a lot of GREAT breeders here as well....
Last edited by KevinK; 11-02-2017 at 08:04 AM.
-
The Following User Says Thank You to KevinK For This Useful Post:
Craiga 01453 (11-02-2017)
-
Personally I have problems communicating with the real large breeders that have thousands of snakes, I think I get lost in the crowd. I prefer to buy from the smaller breeder, communication is instant and they will text or email you right away in most cases. I pretty much buy everything from Morphmarket anymore.
-
-
If you want to buy local, MorphMarket has map that shows the locations of the different sellers. It looks like there are quite a few in NC:
https://www.morphmarket.com/us/stores/map/?cat=reps
So long as you do your due diligence on researching who you plan to buy from you should be fine.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Don't forget that you should pick a breeder that is also feeding according to your preference in prey. If you are against feeding live and plan on feeding f/t, find a breeder that is already feeding f/t before selling. Once you find something you like, call them up or email if you do not like phone calls and talk to them, ask some questions and make sure you are comfortable with them before even thinking of buying. If they brush you off or are rude, chances are they are not a good breeder and you risk the chance of getting a less than healthy snake. Breeders are there for one thing, to sell their product. If they don't take the time to answer a customer's question, what time are they taking to take care of their livestock?
Before even setting foot into the wonderful world of noodles, make sure you get the best habitat you can afford for them. Do you have something in mind and have you researched some of the care techniques? Best to get the enclosure squared away before they come home.
1.0 ♂ 2010 Spider BP 'Dante'
1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
0.0.1 2017 Aru GTP 'Ganja'
1.0 ♂ Blue Tick Coonhound 'Blue'
1.0 ♂ 2018 Basset Hound 'Cooper'
-
The Following User Says Thank You to SDA For This Useful Post:
Craiga 01453 (11-02-2017)
-
Re: Ball Python Breeders?
We have amazing reputable breeders right here on the forum!
 Stay in peace and not pieces.
-
The Following 3 Users Say Thank You to Albert Clark For This Useful Post:
Craiga 01453 (11-02-2017),JodanOrNoDan (11-02-2017),PitOnTheProwl (11-02-2017)
-
There is an exceptional breeder in NC. You can look him up or contact him through IG.
@ssscales
"Passion Breeds Quality, Quality Breeds Desire" - Tim
-
-
There are good breeders in NC both are on Facebook and both attend NC shows (Charlotte, Raleigh) and SC show (Columbia)
Wreckroom Snakes
Royal Reptilia
There is the Charlotte show in December, and if you do not mind the drive there is the Columbia show this weekend in SC
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Registered User
Are there any local reptile shows coming up near you? You maybe could do a combined online / reptile reconnaissance? The above breeders that have been listed are stellar!
I'm a newbie myself, so other experienced breeders and owners may have better advice. There were a couple morph's I liked. And for my price range, it came down to a female BEL. I did some initial research to see what average price was on a BEL on Morph Market. I went to a few local reptile shows, and talked to some breeders and looked at their prices, and get a feel for their personality. I found a breeder that had his own line of BEL, he had a great reputation, and his price was on par with what I had seen online. With his good reputation, I was comfortable pre-paying for my BEL, and picked her up at a local show.
The other nice thing is if you can find a good local show, you can pick up supplies for your new beep. 
Have fun researching!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|