Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,495

1 members and 1,494 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Results 1 to 10 of 14

Hybrid View

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Orange Dream: Does it age well?

    Quote Originally Posted by rufretic View Post
    OD is interesting in that it seems to age well when combined with the right morphs but on its own, at least from what I’ve seen, the orange color does not hold up well. The few adults I’ve seen have had beautiful clean patterns but had lost that bright orange coloring that you see when they are young.
    Ruf is correct about the single gene, as they age they mostly end up looking like a really nice clean normal


    Quote Originally Posted by rufretic View Post
    As for what morphs help them retain the color, enchi is the best that I’ve seen...
    Enchi is certainly one of the better morphs to combo with to help retain the colour into adulthood but even then the adults I have seen of this combo still end up a bit muted. Your other top candidates are Spider, Fire and anything in the YB group. Also, depending on the mix, Pastel can do some really nice things (the flip side being that in the wrong mix, Pastel swamps out the OD.) As a general rule of thumb, the dark morphs and the hetBluEL group do not go that well with OD, with some exceptions

    I have OD Pastel YB (600g), Butter OD Pastel Woma YB (600g) and Butter Enchi OD Pastel YB (1100g) and they are all very bright. And I had an Enchi OD YB that went to live with a friend that was retina-burning


    Quote Originally Posted by cchardwick View Post
    You can hardly tell a yellow belly from a normal when it's on it's own
    This is the third or fourth time I have seen this comment from you and I find it odd. YB is an established incomplete-dominant trait and it is not at all difficult to identify


    Quote Originally Posted by cchardwick View Post
    I'm thinking that there are many different lines of yellow belly with slight differences.
    That there are multiple lines of YB is an established fact -- RDR's Goblin, NERDs Bling, Seigel's OB, the dozen or so independently imported WCs that come in every year... And yes, each might have a slightly different expression pattern but they are all pretty obviously YBs
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (10-30-2017),Albey (11-03-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1