Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 997

0 members and 997 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 8 of 8

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Thoughts on mixing phantom with mystic

    Quote Originally Posted by JodanOrNoDan View Post
    I am curious as to what differences you are seeing between the two lines are...
    I have seen a difference in Purple Passion/Mystic Potions that I think is pretty consistent
    It is subtle things that are, yes, mostly when seen within the rest of the BluEL group but then the same holds for the different lines of Special as well. The differences you noted between the Passions versus the Potions, also differences in the supers themselves. The tendency toward dorsal striping in the more extreme heteroallelic supers (Karma versus Lesser/Mystic, Leche versus Mocha/Mystic). There also seems to be a slightly higher degree of lateral pattern disruption in Phantom combos versus Mystic combos.


    Quote Originally Posted by JodanOrNoDan View Post
    It may have more to do with the level of darkness in the mojave gene.
    While I do not discount this possibility the differences I have seen extend beyond just Mojave combos so I do not think it is the sole cause


    Quote Originally Posted by JodanOrNoDan View Post
    ...but I no longer think that the lines in my collection are different...
    If memory serves me, NERD has their own line of independently imported Phantom. I think the first PurplePassions photographed were from that line. So your speculation may have merit...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (10-19-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1