Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 657

0 members and 657 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,078
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
Welcome to our newest member, TaraLaboureyas
Page 1 of 2 12 LastLast
Results 1 to 10 of 11

Thread: Scaleless het?

  1. #1
    Registered User
    Join Date
    10-06-2017
    Posts
    9
    Thanks
    4
    Thanked 2 Times in 2 Posts

    Scaleless het?

    Just wondering if this is anything special or if someone has some input. This is my little pied baby; I love her dearly.

    Mainly this separated scale at the vent that I have never seen split before.

    Sent from my SM-G900V using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Split vent scales are not at all uncommon, I have dozens of animals with them. Unless you spent a few thousand dollars on her I doubt that she is a Scalelesshead.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User
    Join Date
    10-06-2017
    Posts
    9
    Thanks
    4
    Thanked 2 Times in 2 Posts

    Re: Scaleless het?

    No she was a rescue, prev. owner sold her to me with lots of bite marks and no genetic info. She has a weird spot on her head also

    Sent from my SM-G900V using Tapatalk

  4. #4
    BPnet Veteran BluuWolf's Avatar
    Join Date
    07-08-2017
    Posts
    564
    Thanks
    143
    Thanked 395 Times in 276 Posts

    Re: Scaleless het?

    "Scaleless het" Is what scaleless head is. A few scales missing from the animals head and the super form is a fully scaleless animal.

    As for this I'm not quite sure what you're referring to? The scales and vent look normal to me lol

    Sent from my LG-D690 using Tapatalk

  5. The Following User Says Thank You to BluuWolf For This Useful Post:

    Albert Clark (10-16-2017)

  6. #5
    BPnet Senior Member AbsoluteApril's Avatar
    Join Date
    03-05-2014
    Location
    Utah
    Posts
    2,080
    Thanks
    2,325
    Thanked 2,605 Times in 1,296 Posts

    Re: Scaleless het?

    Quote Originally Posted by SnekDude View Post
    No she was a rescue, prev. owner sold her to me with lots of bite marks and no genetic info. She has a weird spot on her head also
    the missing scales on the top of the head are probably from an old bite wound then
    ****
    For the Horde!

  7. #6
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    I'm not sure, post a better photo of the head... Scaleless head is a bit tricky, I've seen some that look almost normal selling as scaleless head, to me that looks like a real scaleless head. There are more or less amounts of expression, the one I have has a bald head, others you can hardly tell. It's possible an early breeder made a mistake and sold a scaleless head as a normal and it worked it's way into this pied. Personally I'd pair it up with a male scaleless head if you can find or borrow one in the off season, you may get some high dollar scaleless animals! I have a male scaleless head but he is breeding several females at the moment LOL. Prices have come down a lot, even the big breeders are selling male scaleless head normals for $1,500. Next year they will probably go a bit lower, in a few years they will be within reach of everyone. Lots of tables at NARBC have worked scaleless head into their snakes, even saw a few totally scaleless ball pythons.

    By the way, if you feed live please check on the animals in about five minutes (snake + rat) to prevent snake damage. I'm trying live feedings now, all my snakes are finally eating, found out the hard way that 20 minutes with a rat is too long. Had a few small bite marks on one of my pied females... Once a rat figures it out and becomes defensive it's better to euthanize that rat and use it for a frozen thawed feeding the next time, I never use an uneaten live feeder more than once.
    Last edited by cchardwick; 10-16-2017 at 02:03 PM.


  8. #7
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Speaking of scaleless heads, check out this female normal scaleless head selling on Morphmarket for $2,000. Check out the head shot I zoomed in on, I can't see it? Where's the scaleless head? This is what I'm talking about, even I need more experience figuring this out...

    EDITED:13. Respect bandwidth, copyrights, and ownership. Do not "hot-link" images from other websites or post copyrighted material without the express, written permission of the owner.
    Last edited by Stewart_Reptiles; 10-16-2017 at 02:36 PM.


  9. #8
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    What you see on the head is "scar" tissue missing scales likely due to head rubbing, very different than scaleless head

    While Scaleless Head Pied have been produced recently it will run you about 5K
    Last edited by Stewart_Reptiles; 10-16-2017 at 04:10 PM.
    Deborah Stewart


  10. #9
    Registered User
    Join Date
    10-06-2017
    Posts
    9
    Thanks
    4
    Thanked 2 Times in 2 Posts

    Re: Scaleless het?

    Quote Originally Posted by cchardwick View Post
    I'm not sure, post a better photo of the head... Scaleless head is a bit tricky, I've seen some that look almost normal selling as scaleless head, to me that looks like a real scaleless head. There are more or less amounts of expression, the one I have has a bald head, others you can hardly tell. It's possible an early breeder made a mistake and sold a scaleless head as a normal and it worked it's way into this pied. Personally I'd pair it up with a male scaleless head if you can find or borrow one in the off season, you may get some high dollar scaleless animals! I have a male scaleless head but he is breeding several females at the moment LOL. Prices have come down a lot, even the big breeders are selling male scaleless head normals for $1,500. Next year they will probably go a bit lower, in a few years they will be within reach of everyone. Lots of tables at NARBC have worked scaleless head into their snakes, even saw a few totally scaleless ball pythons.

    By the way, if you feed live please check on the animals in about five minutes (snake + rat) to prevent snake damage. I'm trying live feedings now, all my snakes are finally eating, found out the hard way that 20 minutes with a rat is too long. Had a few small bite marks on one of my pied females... Once a rat figures it out and becomes defensive it's better to euthanize that rat and use it for a frozen thawed feeding the next time, I never use an uneaten live feeder more than once.
    I only feed live, not only do I enjoy it more but I firmly believe the snake gets more natural exercise as opposed to many of these snakes you see eating off a stick and barely using any energy to constrict.
    That being said: non pinky will not be left in an enclosure for longer than 15 min and never unattended as I film all my feedings for extra record.

    I was afraid the marks on her head was scarring but I have never seen anything like it before. She is nearing shed and and all these little red marks are showing up


    She is very calm and the moment and cooperated for some clear pictures.

    All my females are so gentle while in blue and never abnormally skittish also.
    Anyone else have this experience?


    Sent from my SM-G386T1 using Tapatalk
    Last edited by SnekDude; 10-20-2017 at 12:06 AM.

  11. #10
    Registered User
    Join Date
    10-06-2017
    Posts
    9
    Thanks
    4
    Thanked 2 Times in 2 Posts

    Re: Scaleless het?

    Quote Originally Posted by SnekDude View Post
    I only feed live, not only do I enjoy it more but I firmly believe the snake gets more natural exercise as opposed to many of these snakes you see eating off a stick and barely using any energy to constrict.
    That being said: non pinky will not be left in an enclosure for longer than 15 min and never unattended as I film all my feedings for extra record.

    I was afraid the marks on her head was scarring but I have never seen anything like it before. She is nearing shed and and all these little red marks are showing up


    She is very calm and the moment and cooperated for some clear pictures.

    All my females are so gentle while in blue and never abnormally skittish also.
    Anyone else have this experience?


    Sent from my SM-G386T1 using Tapatalk
    Ugh I mean if that is scarring it looks SO deep and like it could have been very painful.

    This girl let's me hold her head and is usually pretty calm when I give her a thorough look over; crease spreading, lip, cheek and jaw checks for mites etc.

    Which the calmness and trust I hope is a sign that she wasn't intentionally mistreated by previous owner.

    Sent from my SM-G386T1 using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1