Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 561

0 members and 561 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 8 of 8

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Thoughts on mixing phantom with mystic

    Quote Originally Posted by JodanOrNoDan View Post
    I know that Phantom and Mystic are two different lines of the same gene.
    Tracking some of the trends on these for the last few years I am actually inclined to think that they might indeed be different alleles from one another. Not radically different mind, something along the lines of Baker-line Special versus TCR-line Special kind of different.


    Now, as far as mixing the lines... Personally, I would be leery of blending them, for pretty much the reasons Ax outlined. But that is just me. Ultimately it is up to you on whether you want to move your project on faster or whether you want to keep pure lines.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (10-16-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1