Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,003

1 members and 1,002 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,701
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 1 of 2 12 LastLast
Results 1 to 10 of 12
  1. #1
    BPnet Veteran Crowfingers's Avatar
    Join Date
    09-27-2015
    Location
    Hayfield Virginia
    Posts
    909
    Thanks
    416
    Thanked 691 Times in 400 Posts
    Images: 11

    Calico White question

    So, I know that I have been really into pieds recently but my fiance is also really into calico / sugars. In all honesty my draw to pieds is the contrast between white and dark patterns and a calico satisfies that (they are also much more in my price range).

    Anyway, I've just been perusing morph market and had a small question...do they hatch with the white or does it develop with age? Most of the hatchlings have pinkish tan blushing (if that's the right term) on the sides and I haven't seen a hatchling with actual white sides.
    The enchi and mojave calico's are really cool looking and if having a calico instead of a pied gets me another snake...I can certainly live with that
    No cage is too large - nature is the best template - a snoot can't be booped too much


  2. #2
    BPnet Veteran Potatoren's Avatar
    Join Date
    07-20-2017
    Posts
    299
    Thanks
    79
    Thanked 392 Times in 169 Posts

    Re: Calico White question

    The pink turns to white. My mocha calico was very pink at hatchling age

    Sent from my SM-G920P using Tapatalk

  3. The Following User Says Thank You to Potatoren For This Useful Post:

    Crowfingers (10-05-2017)

  4. #3
    BPnet Veteran Crowfingers's Avatar
    Join Date
    09-27-2015
    Location
    Hayfield Virginia
    Posts
    909
    Thanks
    416
    Thanked 691 Times in 400 Posts
    Images: 11

    Re: Calico White question

    I'm also really wanting a female this time, my male is great - sweet, calm, clean...and up until his last shed was a great eater...now of course he is going through a fast for no reason at all. But the size that the females can reach is a strong draw to me. My male just hit 1200g and it sounded much bigger than it actually is when I was originally debating gender...
    No cage is too large - nature is the best template - a snoot can't be booped too much


  5. #4
    BPnet Veteran Potatoren's Avatar
    Join Date
    07-20-2017
    Posts
    299
    Thanks
    79
    Thanked 392 Times in 169 Posts

    Re: Calico White question

    Quote Originally Posted by Crowfingers View Post
    I'm also really wanting a female this time, my male is great - sweet, calm, clean...and up until his last shed was a great eater...now of course he is going through a fast for no reason at all. But the size that the females can reach is a strong draw to me. My male just hit 1200g and it sounded much bigger than it actually is when I was originally debating gender...
    Lol im just about to pick up a 4000+ gram female.
    I'm not sure how well you can see how pink he was versus now, but here's difference pics. Top view is most recent

    Sent from my SM-G920P using Tapatalk

  6. The Following User Says Thank You to Potatoren For This Useful Post:

    Crowfingers (10-05-2017)

  7. #5
    BPnet Veteran Crowfingers's Avatar
    Join Date
    09-27-2015
    Location
    Hayfield Virginia
    Posts
    909
    Thanks
    416
    Thanked 691 Times in 400 Posts
    Images: 11

    Re: Calico White question

    Quote Originally Posted by Potatoren View Post
    Lol im just about to pick up a 4000+ gram female.
    I'm not sure how well you can see how pink he was versus now, but here's difference pics. Top view is most recent Sent from my SM-G920P using Tapatalk
    Oooh so cool! thanks for sharing. love the yellows! I wish my male wasn't fading so fast. His browns were so rich and chocolaty when I first got him but hes fading to tan and darker tan with each shed. Still a lovely snake, just not as eye-popping as he was
    No cage is too large - nature is the best template - a snoot can't be booped too much


  8. #6
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    Maybe look for a darker morph calico if you want the snake to keep good contrast. My cinnamon has stayed very dark with good contrast, so I'd imagine a cinnamon calico would hold contrast really well.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  9. The Following User Says Thank You to artgecko For This Useful Post:

    Crowfingers (10-06-2017)

  10. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Calico White question

    Quote Originally Posted by artgecko View Post
    Maybe look for a darker morph calico if you want the snake to keep good contrast. My cinnamon has stayed very dark with good contrast, so I'd imagine a cinnamon calico would hold contrast really well.
    I would avoid a Cinny combo if your goal is high white in a Calico, the SuperBlk complex seems to dampen the expression of Calico.

    For high expression on Calicos combos with Enchi, Spider, and Pastel are your best bet.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    Crowfingers (10-06-2017)

  12. #8
    BPnet Veteran Crowfingers's Avatar
    Join Date
    09-27-2015
    Location
    Hayfield Virginia
    Posts
    909
    Thanks
    416
    Thanked 691 Times in 400 Posts
    Images: 11

    Re: Calico White question

    I really like the pastel calico's and enchi is always nice.

    This is a cropped section of the snake I'm looking at - just to show the pale along the belly

    (hope this is enough to give you all an idea of the area I'm talking about) Is the blushing where the white will develop with age? This faded color on the ventral side continues the full length of the body. What do you all think?

    [IMG][/IMG]
    Last edited by Crowfingers; 10-06-2017 at 08:17 PM.
    No cage is too large - nature is the best template - a snoot can't be booped too much


  13. The Following User Says Thank You to Crowfingers For This Useful Post:

    Pelican't (10-07-2017)

  14. #9
    BPnet Veteran Crowfingers's Avatar
    Join Date
    09-27-2015
    Location
    Hayfield Virginia
    Posts
    909
    Thanks
    416
    Thanked 691 Times in 400 Posts
    Images: 11

    Re: Calico White question

    Second question as well - if I were to go pastel calico / pastel sugar - do a pastels eyes stay green when mixed with other morphs?
    I just want to know exactly what I want before buying this time
    Last edited by Crowfingers; 10-08-2017 at 12:25 PM.
    No cage is too large - nature is the best template - a snoot can't be booped too much


  15. #10
    BPnet Veteran Potatoren's Avatar
    Join Date
    07-20-2017
    Posts
    299
    Thanks
    79
    Thanked 392 Times in 169 Posts

    Re: Calico White question

    Quote Originally Posted by Crowfingers View Post
    Second question as well - if I were to go pastel calico / pastel sugar - do a pastels eyes stay green when mixed with other morphs?
    I just want to know exactly what I want before buying this time
    Yup
    Pastel calico adult male eye for example.

    Sent from my SM-G920P using Tapatalk

  16. The Following User Says Thank You to Potatoren For This Useful Post:

    Crowfingers (10-08-2017)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1