» Site Navigation
0 members and 680 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
All the ways to get a white ball python?
I'm wondering about all the ways to get a white ball python. Not just black or blue eye Lucy's. Anything all white or almost all white. So like grey freckiling and stuff is fine. Pics would be wonderful. Abvioisly include the combo names of both parents
-
-
Registered User
Re: All the ways to get a white ball python?
Yellowbelly x yellowbelleys make ivorys which can sometimes have abit of patterning.
Spider pieds have a completely white body with a patterned head which looks cool. Blue eyed lucies vary in colour and whiteness too. Super mojaves have a grey head.
Sent from my iPhone using Tapatalk
-
-
Re: All the ways to get a white ball python?
Last edited by Ax01; 10-03-2017 at 06:23 PM.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 2 Users Say Thank You to Ax01 For This Useful Post:
Godzilla78 (10-04-2017),ViolentTides (10-03-2017)
-
Registered User
Re: All the ways to get a white ball python?
I never knew a lesser pied made a white snake. So that’s a pied x lesser het pied right? And the snow balls are absolutely beautiful
-
-
Re: All the ways to get a white ball python?
 Originally Posted by CrazycatOP
I never knew a lesser pied made a white snake. So that’s a pied x lesser het pied right? And the snow balls are absolutely beautiful
that's one way to get them. other pairings may include:
Lesser het Pied x Lesser het Pied
Lesser Pied x Pied
Lesser het Pied x het Pied
Lesser Pied x het Pied
any Lesser-combo het Pied x Pied
etc. etc.
u can also swap out Lesser for Butter i suppose.
but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.

i'm lucky in that my Ruby girl is perfect. (:
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Registered User
Re: All the ways to get a white ball python?
Ever heard of a super orange belly? Not a yellow belly. Do they produce white snakes? I’m getting mixed info
-
-
Registered User
Re: All the ways to get a white ball python?
 Originally Posted by Ax01
that's one way to get them. other pairings may include:
Lesser het Pied x Lesser het Pied
Lesser Pied x Pied
Lesser het Pied x het Pied
Lesser Pied x het Pied
any Lesser-combo het Pied x Pied
etc. etc.
u can also swap out Lesser for Butter i suppose.
but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.
i'm lucky in that my Ruby girl is perfect. (:
Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.
Sent from my iPhone using Tapatalk
-
-
Re: All the ways to get a white ball python?
 Originally Posted by CrazycatOP
Ever heard of a super orange belly? Not a yellow belly. Do they produce white snakes? I’m getting mixed info
OB is just another allele of YB. OB x YB makes an Ivory. Some people argue that all OB x OB will produce a GraphiteIvory but I have yet to see any documented proof of this.
 Originally Posted by Python23
Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.
I have heard it argued that the white of a Pied is brighter/cleaner than the white of any BluEL, so it might not be a totally pointless project in that regard.
Other white snakes:
WomaPied and ChampPied can be all white
There are some lines of BlkPastel that will occasionally throw all-whites when combined with Pied in the same manner as Spieds
Any of the superforms in the BluEL group (with the possible exception of the Daddy allele) when combined with Pied; e.g., CrystalPied, PotionPied... But, as noted above, you get microphthalmia.
Snows (already mentioned) and LavSnows
If you stack enough other genes in Champs they seem to wash down to near-white, e.g., SuperPastel Champ Fire Lesser
Albino SuperBlk/SuperCinny/8Ball though these might blush yellow with age
Albino Suma might as well though I suspect they might blush yellow the same as above
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: All the ways to get a white ball python?
 Originally Posted by Ax01
that's one way to get them. other pairings may include:
Lesser het Pied x Lesser het Pied
Lesser Pied x Pied
Lesser het Pied x het Pied
Lesser Pied x het Pied
any Lesser-combo het Pied x Pied
etc. etc.
u can also swap out Lesser for Butter i suppose.
but keep in mind Lesser Pieds are susceptible to Microphthalmia aka small eyes. get Super Lessers and they may get big, buggy eyes. get Lesser Pieds and they may have small eyes.
i'm lucky in that my Ruby girl is perfect. (:
 Originally Posted by Python23
Breeding super lesser pieds is absolutely pointless in my opinion. You're just going to get a completely white snake, which is a waste of the pied gene. If people want a white snake you might aswell do it with as little genes as possible.
i've seen one Super Lesser Pied that had an all white body but with a lavenderish belly kinda like this lucy Burm: https://ball-pythons.net/forums/show...leucistic-baby i don't know if that was a once off, paradox thing tho. and a Super Lesser Pied can be very helpful in a project if the breeder wants to work the Lesser gene into everything (and create het Pieds). so no, its not absolutely pointless IMO. also Pied Lesser's and Pied Super Lesser's do not have blue eyes; they have black eyes w/ red pupils. so they offer something different besides their genetic power u can work into other projects. but to each their own.
Edit:
 Originally Posted by asplundii
I have heard it argued that the white of a Pied is brighter/cleaner than the white of any BluEL, so it might not be a totally pointless project in that regard.
true dat!
Last edited by Ax01; 10-04-2017 at 12:57 PM.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Registered User
Re: All the ways to get a white ball python?
What is the simplest definition of an allele? I know it’s a gene related to another but how?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|