Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 820

0 members and 820 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,100
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 3 of 3 FirstFirst 123
Results 21 to 28 of 28
  1. #21
    Registered User Pezz's Avatar
    Join Date
    09-20-2017
    Posts
    426
    Thanks
    21
    Thanked 196 Times in 152 Posts

    Re: Help. I have a rescue but unsure on the genetics.

    Quote Originally Posted by AbsoluteApril View Post
    Like others have said, in the first photo the washed out color looks lesser/butter but in the other two photos (which I assume are closer to actual colors) it does look caramel.
    Actually the first is closer to her colors. The less lighting and shadows in the 2nd and 3rd exaggerated the darker paterning. She's so light that at first i suspected she had ghost. I've been able to rule that out after a shed, and as I've said to others I've thoroughly examined her eyes and they have no signs of albinoism ruling out a caramel. The possibility of an ultramel still exists.

    Sent from my LG-M151 using Tapatalk

  2. #22
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    Personally I would not breed that snake unless you know for sure what the genetics are. You may figure out it's recessive or co-dom by breeding but you wont really know if it's caramel, ultramel, a new type of morph, etc... you may mislead people that buy the babies. I'm guessing that's why big breeders can get a better price for their snakes, the genetics are guaranteed, they don't mess around with breeding snakes with unknown genetics and then guessing. Probably why it was passed on as a 'rescue'. I'd start with the person you got it from, ask them where they got it from and trace it back, see if you can track it down. If it came from a big chain pet store you may be able to find the breeder that sells to them and ask the breeder. That's a good looking snake though, and a great size for breeding!
    Last edited by cchardwick; 10-03-2017 at 07:26 AM.


  3. The Following User Says Thank You to cchardwick For This Useful Post:

    Pezz (10-03-2017)

  4. #23
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This animal is a Lesser (or Butter, no difference other than the name). There is absolutely no doubt.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    Pezz (10-03-2017)

  6. #24
    Registered User Pezz's Avatar
    Join Date
    09-20-2017
    Posts
    426
    Thanks
    21
    Thanked 196 Times in 152 Posts

    Re: Help. I have a rescue but unsure on the genetics.

    Quote Originally Posted by cchardwick View Post
    Personally I would not breed that snake unless you know for sure what the genetics are. You may figure out it's recessive or co-dom by breeding but you wont really know if it's caramel, ultramel, a new type of morph, etc... you may mislead people that buy the babies. I'm guessing that's why big breeders can get a better price for their snakes, the genetics are guaranteed, they don't mess around with breeding snakes with unknown genetics and then guessing. Probably why it was passed on as a 'rescue'. I'd start with the person you got it from, ask them where they got it from and trace it back, see if you can track it down. If it came from a big chain pet store you may be able to find the breeder that sells to them and ask the breeder. That's a good looking snake though, and a great size for breeding!
    Was a rescue because her original owner lost their house to the wildfires that rocked B.C this year. That's why i am unable to get a hold of him to trace the line.

    Sent from my LG-M151 using Tapatalk

  7. #25
    BPnet Senior Member AbsoluteApril's Avatar
    Join Date
    03-05-2014
    Location
    Utah
    Posts
    2,080
    Thanks
    2,325
    Thanked 2,605 Times in 1,296 Posts

    Re: Help. I have a rescue but unsure on the genetics.

    Quote Originally Posted by Pezz View Post
    Actually the first is closer to her colors. The less lighting and shadows in the 2nd and 3rd exaggerated the darker paterning.
    Ahh okay then yes, lesser/butter
    ****
    For the Horde!

  8. #26
    Registered User Pezz's Avatar
    Join Date
    09-20-2017
    Posts
    426
    Thanks
    21
    Thanked 196 Times in 152 Posts

    Re: Help. I have a rescue but unsure on the genetics.

    Quick update. Got hold of the original owner traced her back to the breeder Marcus Jayne. She's a lesser from the Ralph Davis line.

    Sent from my LG-M151 using Tapatalk

  9. The Following User Says Thank You to Pezz For This Useful Post:

    Albert Clark (10-03-2017)

  10. #27
    Registered User Chinnamasta's Avatar
    Join Date
    10-06-2017
    Location
    Atlanta, Georgia
    Posts
    29
    Thanks
    19
    Thanked 12 Times in 6 Posts
    Images: 7
    I agree with caramel. Very beautiful!

  11. #28
    Registered User Pezz's Avatar
    Join Date
    09-20-2017
    Posts
    426
    Thanks
    21
    Thanked 196 Times in 152 Posts

    Re: Help. I have a rescue but unsure on the genetics.

    Quote Originally Posted by Chinnamasta View Post
    I agree with caramel. Very beautiful!
    Tracked her back to the breeder. She's a lesser from the Ralph Davis line.

    Sent from my LG-M151 using Tapatalk

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1