Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,038

0 members and 1,038 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 24

Thread: White Python

  1. #11
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: White Python

    Quote Originally Posted by Charles8088 View Post
    This is a follow-up to an earlier thread I posted almost 2 months ago:
    https://ball-pythons.net/forums/show...st-white-morph

    Getting ready to make the "white python" purchase. I saw several balls I'm interested in, seemingly all-white (so it looks like in the pictures), on Morph Market. Out of these gene combos, which are most-likely to be more pure white, and better chance of remaining so:

    Lesser x Mojave
    Super Fire
    Super Lesser
    Super Lesser x Mojave
    Super Mojave
    Super Mojave x Leopard
    Super Mojave x 100% Het Ghost
    Super Russo x Butter

    Thanks.
    Quote Originally Posted by dr del ❤️ View Post
    Someone correct me if I'm wrong but the ones in bold cannot possible exist - if someone tries to sell you those run far and run fast.
    oh u can have A Super Lesser Mojo or Super Russo (White Diamond) x Butter. they would just be all white and have no pattern b/c of the leucism. it would just be hard to tell until u breed/prove it out. it's the same concept as having a Super Pastel Leopard or any other Supers with extra gene(s).
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  2. The Following User Says Thank You to Ax01 For This Useful Post:

    Charles8088 (10-09-2017)

  3. #12
    BPnet Veteran Charles8088's Avatar
    Join Date
    02-14-2017
    Posts
    548
    Thanks
    806
    Thanked 468 Times in 215 Posts
    Images: 13
    The Super Lesser/Mojave and the Super Russo/Butter were on Morph Market (as were all the others, really). Unfortunately, don't know the sellers, so cannot attest to their accuracy or honesty, even. But, the pics (if true) look nice.

    The Super Russo x Butter:
    https://www.morphmarket.com/us/c/rep...-pythons/89080

    The Super Lesser x Mojave:
    https://www.morphmarket.com/us/c/rep...-pythons/90970

    And, you know, I haven't researched the sellers yet, but if anyone knows any good or bad stuff about either, please do tell.

    Thank you.
    0.1 Mexican Black Kingsnake (Tynee)
    0.1 BEL Ball (Luna)
    0.1 Sunglow Boa (Pippi Longsnake)
    0.1 Woma Python (Uma)


    WANT LIST
    - Mangrove Snake

    - Russian Rat Snake
    - Eastern Indigo
    - Black Milk Snake
    - False Water Cobra
    - Rhino Rat Snake
    - Thai Bamboo Rat Snake
    - Western Hognose
    - Kenyan Sand Boa

  4. #13
    BPnet Veteran MmmBanana's Avatar
    Join Date
    03-28-2017
    Posts
    320
    Thanks
    43
    Thanked 197 Times in 126 Posts

    Re: White Python

    Quote Originally Posted by Charles8088 View Post
    Description. Nice female Blue Eyed Lucy available. Has eaten every week for the past 2 months since it's hatch date. Came from a Super Russo x Butter clutch. Message for shipping quotes as well as additional information or pictures. Payments accepted through PayPal friends and family.


    Sounds like a russo butter. Not a super russo butter, right? Also, this is unrelated, but he is asking for payment through friends and family which is extremely sketchy......
    Last edited by MmmBanana; 09-26-2017 at 02:42 PM.

  5. The Following User Says Thank You to MmmBanana For This Useful Post:

    Charles8088 (10-09-2017)

  6. #14
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: White Python

    Quote Originally Posted by Ax01 View Post
    oh u can have A Super Lesser Mojo or Super Russo (White Diamond) x Butter. they would just be all white and have no pattern b/c of the leucism. it would just be hard to tell until u breed/prove it out. it's the same concept as having a Super Pastel Leopard or any other Supers with extra gene(s).
    Ah sorry - I thought they were claiming the animal had two copies of the lesser gene and a copy of the mojo gene - putting it as a mojo lesser bel seemed the logical way to name it to me.

    You can only have two genes on a pair and lesser and mojo being allelic rules out what I thought he was describing.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  7. The Following User Says Thank You to dr del For This Useful Post:

    Charles8088 (10-09-2017)

  8. #15
    BPnet Veteran Charles8088's Avatar
    Join Date
    02-14-2017
    Posts
    548
    Thanks
    806
    Thanked 468 Times in 215 Posts
    Images: 13

    Re: White Python

    Quote Originally Posted by MmmBanana View Post
    ...Also, this is unrelated, but he is asking for payment through friends and family which is extremely sketchy......
    Thanks for the heads up. Yea, based on how he's advertising and how he answered an inquiry I had on the snake, it looks like he might just be be starting out. And, I myself am fairly new, and never heard of the seller.

    I would never pay Friends & Family. There are several other snakes I am looking at as well, but if I go with this girl I would ask the seller to not use Friends & Family, and even offer to pay the paypal fee if that was his main concern.
    0.1 Mexican Black Kingsnake (Tynee)
    0.1 BEL Ball (Luna)
    0.1 Sunglow Boa (Pippi Longsnake)
    0.1 Woma Python (Uma)


    WANT LIST
    - Mangrove Snake

    - Russian Rat Snake
    - Eastern Indigo
    - Black Milk Snake
    - False Water Cobra
    - Rhino Rat Snake
    - Thai Bamboo Rat Snake
    - Western Hognose
    - Kenyan Sand Boa

  9. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Having compared them over the past few years I still contend that, as adults, a pure white BlkEL is cleaner than any of the BluELs. Every adult of the latter that I have seen has always had a very slight yellow tint to it, making them look more cream-coloured than white.

    And, as was noted, the all white Pied variants (LesserPied, BluEL Pied, WhiteWedding, etc.) also tend to stay shock white
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    Charles8088 (09-27-2017)

  11. #17
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: White Python

    Quote Originally Posted by Charles8088 View Post
    Thanks for the heads up. Yea, based on how he's advertising and how he answered an inquiry I had on the snake, it looks like he might just be be starting out. And, I myself am fairly new, and never heard of the seller.

    I would never pay Friends & Family. There are several other snakes I am looking at as well, but if I go with this girl I would ask the seller to not use Friends & Family, and even offer to pay the paypal fee if that was his main concern.

    There are plenty of reputable breeders producing the snakes you're interested in. I would look at the friends and family thing as a HUGE red flag and cross that snake off your list. You'll find what you're looking for elsewhere with no problem, why risk it? You're going to have this animal 25+ years, not worth taking a chance on a sketchy situation.

  12. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Charles8088 (09-27-2017)

  13. #18
    BPnet Veteran Charles8088's Avatar
    Join Date
    02-14-2017
    Posts
    548
    Thanks
    806
    Thanked 468 Times in 215 Posts
    Images: 13
    Final thoughts?

    I've pinned it down to these two. DISCLAIMER: These are not my photos.

    The first is a Super Mojave by Dynasty Reptiles listed on Morph Market.

    The second is a Mojave Russo x Pastel Lesser from Wenjun Li (aka Riplee) listed on Facebook.

    I know pictures are not always accurate, so opinions and thoughts based on the genes are welcomed.

    I don't mind the little grey on the head (looks cool actually). Which do you folks think is more likely to stay white?



    0.1 Mexican Black Kingsnake (Tynee)
    0.1 BEL Ball (Luna)
    0.1 Sunglow Boa (Pippi Longsnake)
    0.1 Woma Python (Uma)


    WANT LIST
    - Mangrove Snake

    - Russian Rat Snake
    - Eastern Indigo
    - Black Milk Snake
    - False Water Cobra
    - Rhino Rat Snake
    - Thai Bamboo Rat Snake
    - Western Hognose
    - Kenyan Sand Boa

  14. #19
    BPnet Veteran
    Join Date
    09-13-2017
    Posts
    594
    Thanks
    1,160
    Thanked 507 Times in 292 Posts

    Re: White Python

    Absolutely stunning!! Love the "whites"....



  15. The Following User Says Thank You to Jus1More For This Useful Post:

    Charles8088 (10-09-2017)

  16. #20
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43
    i love super mojaves the grey on the head gives them a nice contrast. Also i got my pastel enchi banana from Dynasty Reptiles, hes got really nice quality bps
    Bels are so stunning in person, pics dont do them justice. like my 2 black eyed lucys and my bel hatchlings are jaw droppers in person ^.^
    Last edited by Alexiel03; 10-09-2017 at 01:41 PM.

  17. The Following User Says Thank You to Alexiel03 For This Useful Post:

    Charles8088 (10-09-2017)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1