Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,091

0 members and 1,091 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 24

Thread: White Python

Threaded View

  1. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Having compared them over the past few years I still contend that, as adults, a pure white BlkEL is cleaner than any of the BluELs. Every adult of the latter that I have seen has always had a very slight yellow tint to it, making them look more cream-coloured than white.

    And, as was noted, the all white Pied variants (LesserPied, BluEL Pied, WhiteWedding, etc.) also tend to stay shock white
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Charles8088 (09-27-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1