Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 562

0 members and 562 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 14 of 14
  1. #11
    Registered User
    Join Date
    01-22-2017
    Posts
    12
    Thanks
    8
    Thanked 2 Times in 2 Posts

    Red pupils on my blue eyed lucy

    Quote Originally Posted by BluuWolf View Post
    Perhaps its the lesser? That's one thing both of yours have in common and if you go and look on the White Python thread on the same Morph section from today (I can't link sense I'm on my phone sry) all the pics on there have red pupils as well, both have lesser one being a super lesser and the other being a lesser pied

    Sent from my LG-D690 using Tapatalk
    Me and the breeder got him under black light again and all we can see is a clear more pure white going up his sides with the odd faint line near his eyes like the spiders have so I'm 75% certain that's what he has. Only way to find out is to breed him and see if he throws out some lesser bees or bumblebees. I suppose that's part of the fun.


    Sent from my iPhone using Tapatalk
    Last edited by Python23; 09-26-2017 at 01:32 AM.

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Red pupils on my blue eyed lucy

    Quote Originally Posted by Ax01 View Post
    honestly i think it's lighting (and dilation) that creates the red eye effect. i've seen pix of the same BEL's that have the red pupil in some pix and the same BEL w/ black pupils in other pix. RedSheperd's (on the forum here) own BEL comes to mind.
    You are correct, it has to do with the light and the angle at which it is entering the eye (also, if you are using any kind of flash.) It is the same as the eyeshine you see in cats sometimes. I have seen this in a number of morphs; BluELs, Banana, Ivory...


    Quote Originally Posted by Python23 View Post
    Me and the breeder got him under black light again and all we can see is a clear more pure white going up his sides with the odd faint line near his eyes
    The Spider pattern under blacklight is not at all subtle, it is bold and obvious and there would be no question that it was there. Based on your description here I do not think your animal has Spider in it
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    BluuWolf (09-27-2017),Python23 (09-26-2017)

  4. #13
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: Red pupils on my blue eyed lucy

    My BEL (first pic) has the red pupils too, from most of the pictures I've seen of them they tend to have them.

    Black eyed Lucy's always have red pupils though (2nd pic)

    Sent from my SM-S120VL using Tapatalk

  5. #14
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: Red pupils on my blue eyed lucy

    Forgot to add my BEL was from a Mojave x Butter Pastel

    Sent from my SM-S120VL using Tapatalk

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1