» Site Navigation
0 members and 539 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: White Python
 Originally Posted by Charles8088
This is a follow-up to an earlier thread I posted almost 2 months ago:
https://ball-pythons.net/forums/show...st-white-morph
Getting ready to make the "white python" purchase. I saw several balls I'm interested in, seemingly all-white (so it looks like in the pictures), on Morph Market. Out of these gene combos, which are most-likely to be more pure white, and better chance of remaining so:
Lesser x Mojave
Super Fire
Super Lesser
Super Lesser x Mojave
Super Mojave
Super Mojave x Leopard
Super Mojave x 100% Het Ghost
Super Russo x Butter
Thanks.
 Originally Posted by dr del ❤️
Someone correct me if I'm wrong but the ones in bold cannot possible exist - if someone tries to sell you those run far and run fast.
oh u can have A Super Lesser Mojo or Super Russo (White Diamond) x Butter. they would just be all white and have no pattern b/c of the leucism. it would just be hard to tell until u breed/prove it out. it's the same concept as having a Super Pastel Leopard or any other Supers with extra gene(s).
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
The Super Lesser/Mojave and the Super Russo/Butter were on Morph Market (as were all the others, really). Unfortunately, don't know the sellers, so cannot attest to their accuracy or honesty, even. But, the pics (if true) look nice.
The Super Russo x Butter:
https://www.morphmarket.com/us/c/rep...-pythons/89080
The Super Lesser x Mojave:
https://www.morphmarket.com/us/c/rep...-pythons/90970
And, you know, I haven't researched the sellers yet, but if anyone knows any good or bad stuff about either, please do tell.
Thank you.
0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
Re: White Python
 Originally Posted by Charles8088
Description. Nice female Blue Eyed Lucy available. Has eaten every week for the past 2 months since it's hatch date. Came from a Super Russo x Butter clutch. Message for shipping quotes as well as additional information or pictures. Payments accepted through PayPal friends and family.
Sounds like a russo butter. Not a super russo butter, right? Also, this is unrelated, but he is asking for payment through friends and family which is extremely sketchy......
Last edited by MmmBanana; 09-26-2017 at 02:42 PM.
-
The Following User Says Thank You to MmmBanana For This Useful Post:
-
Re: White Python
 Originally Posted by Ax01
oh u can have A Super Lesser Mojo or Super Russo (White Diamond) x Butter. they would just be all white and have no pattern b/c of the leucism. it would just be hard to tell until u breed/prove it out. it's the same concept as having a Super Pastel Leopard or any other Supers with extra gene(s).
Ah sorry - I thought they were claiming the animal had two copies of the lesser gene and a copy of the mojo gene - putting it as a mojo lesser bel seemed the logical way to name it to me. 
You can only have two genes on a pair and lesser and mojo being allelic rules out what I thought he was describing.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following User Says Thank You to dr del For This Useful Post:
-
Re: White Python
 Originally Posted by MmmBanana
...Also, this is unrelated, but he is asking for payment through friends and family which is extremely sketchy......
Thanks for the heads up. Yea, based on how he's advertising and how he answered an inquiry I had on the snake, it looks like he might just be be starting out. And, I myself am fairly new, and never heard of the seller.
I would never pay Friends & Family. There are several other snakes I am looking at as well, but if I go with this girl I would ask the seller to not use Friends & Family, and even offer to pay the paypal fee if that was his main concern.
0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
Having compared them over the past few years I still contend that, as adults, a pure white BlkEL is cleaner than any of the BluELs. Every adult of the latter that I have seen has always had a very slight yellow tint to it, making them look more cream-coloured than white.
And, as was noted, the all white Pied variants (LesserPied, BluEL Pied, WhiteWedding, etc.) also tend to stay shock white
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: White Python
 Originally Posted by Charles8088
Thanks for the heads up. Yea, based on how he's advertising and how he answered an inquiry I had on the snake, it looks like he might just be be starting out. And, I myself am fairly new, and never heard of the seller.
I would never pay Friends & Family. There are several other snakes I am looking at as well, but if I go with this girl I would ask the seller to not use Friends & Family, and even offer to pay the paypal fee if that was his main concern.
There are plenty of reputable breeders producing the snakes you're interested in. I would look at the friends and family thing as a HUGE red flag and cross that snake off your list. You'll find what you're looking for elsewhere with no problem, why risk it? You're going to have this animal 25+ years, not worth taking a chance on a sketchy situation.
-
The Following User Says Thank You to Craiga 01453 For This Useful Post:
-
Final thoughts?
I've pinned it down to these two. DISCLAIMER: These are not my photos.
The first is a Super Mojave by Dynasty Reptiles listed on Morph Market.
The second is a Mojave Russo x Pastel Lesser from Wenjun Li (aka Riplee) listed on Facebook.
I know pictures are not always accurate, so opinions and thoughts based on the genes are welcomed.
I don't mind the little grey on the head (looks cool actually). Which do you folks think is more likely to stay white?

0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
Re: White Python
Absolutely stunning!! Love the "whites"....
-
The Following User Says Thank You to Jus1More For This Useful Post:
-
i love super mojaves the grey on the head gives them a nice contrast. Also i got my pastel enchi banana from Dynasty Reptiles, hes got really nice quality bps 
Bels are so stunning in person, pics dont do them justice. like my 2 black eyed lucys and my bel hatchlings are jaw droppers in person ^.^
Last edited by Alexiel03; 10-09-2017 at 01:41 PM.
-
The Following User Says Thank You to Alexiel03 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|