Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 673

0 members and 673 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 39

Threaded View

  1. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by Albert Clark View Post
    Well I know Candino's have the darker ruby eye coloration as opposed to reg albinos that have the pink eye color.
    Candino eyes do not look like that. Especially not at hatching

    Quote Originally Posted by Albert Clark View Post
    The first pic looks like a regular albino.
    Lavs typically hatch out looking like normal Albinos and their colouring flushes in as they age


    Based on the fact that the whole animal is pigmented my inclination is to say it is just genetic variation just popping out and surprising you a bit and the animal is a regular Lav that happened to start colouring up significantly earlier than expected. Odd question -- What were your incubation temps and was this specific animal's egg someplace where it would have been colder than the rest of the eggs?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Albert Clark (09-22-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1