Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 606

0 members and 606 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,118
Posts: 2,572,195
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 21

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you want high expression of white in a Calico combo then go with Enchi or Spider. OD also seems to push toward higher white expression. Pastel combos push higher as well but also tend toward disrupted pattern.

    BluEL complex, BlkEL complex, YB complex, and SuperBlk complex seem to push toward lower expression of the white. Likewise Clown and GStripe seem to cause lower expression. Most of the Calico Pins I have seen have not been particularly dramatic either.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (09-07-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1