Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 717

2 members and 715 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 21
  1. #11
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    Very cool! Thanks for taking the time to post them, nothing beats pictures for showing your point. The firefly calico yb is super cool!

  2. The Following User Says Thank You to rufretic For This Useful Post:

    MS2 (09-06-2017)

  3. #12
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    MS2- Thank you for the pics! I'm assuming the pinkish areas on the belly will turn white with age?

    My main issue with calico is that even when you have high white animals, when they combine with other morphs, I have never seen a high white one produced that still retains patterning..It seems like the calico changes the pattern as well as producing less white in these instances. Maybe I just haven't seen enough of them to see good examples though.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  4. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you want high expression of white in a Calico combo then go with Enchi or Spider. OD also seems to push toward higher white expression. Pastel combos push higher as well but also tend toward disrupted pattern.

    BluEL complex, BlkEL complex, YB complex, and SuperBlk complex seem to push toward lower expression of the white. Likewise Clown and GStripe seem to cause lower expression. Most of the Calico Pins I have seen have not been particularly dramatic either.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (09-07-2017)

  6. #14
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Question about calico (and other morph interactions)

    I love a good high white calibee <3
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  7. #15
    BPnet Veteran MS2's Avatar
    Join Date
    09-13-2010
    Location
    Central Florida
    Posts
    539
    Thanks
    338
    Thanked 229 Times in 121 Posts

    Re: Question about calico (and other morph interactions)


    My girl is a low expression Calico. Here's her on the clutch. Definitely does some wacky stuff with the patterns.


    Sent from my iPad using Tapatalk

  8. #16
    BPnet Veteran Albey's Avatar
    Join Date
    10-29-2006
    Location
    Atlanta, GA
    Posts
    413
    Thanks
    68
    Thanked 263 Times in 109 Posts

    Re: Question about calico (and other morph interactions)



    Pastel Calico Yellow Belly Orange Dream!
    Thanks,
    Albey Scholl
    Albey's Too Cool Reptiles
    Like us on Facebook

  9. The Following User Says Thank You to Albey For This Useful Post:

    MS2 (09-07-2017)

  10. #17
    Registered User
    Join Date
    03-12-2015
    Posts
    136
    Thanks
    18
    Thanked 55 Times in 41 Posts
    Images: 1
    I just hatched out a sweet clutch from my male Banaha hypo x female Calico Killerbee for a pastel, bumblebee, pastel calico, calibee, banana pastel poss calico and a banana calibee. All females except for the banana pastel. I will be holding back the
    female banana calibee as it was my goal for this clutch
    1.0 Banana Hypo
    1.0 Pastave Enchi
    1.0 Pastel +
    0.1 Normal Het. Hypo
    0.1 Killer Blast
    0.1 Killer Calibee
    0.1 Queenbee

  11. #18
    BPnet Veteran EDR's Avatar
    Join Date
    10-29-2015
    Location
    Chicago
    Posts
    642
    Thanks
    750
    Thanked 473 Times in 347 Posts
    Images: 43

    Re: Question about calico (and other morph interactions)

    Hope i'm not side tracking but may i suggest sugar. I like sugar more cause they are more consistent in the middle of the amount of white that show where as calico it tends to either be high or low white. But i do like calico so go either way i guess.

    I just took and uploaded these pics of my sugar bee.





    Out of my whole collection i needed some updated pics of her the most next to my albino boa who is overdo for some new pics. Can you believe i only paid $225 for her. The seller claimed he made a mistake in posting the price and honored the listed price. I'm not a genetic expert but i do believe she is a sugar.
    Last edited by EDR; 09-07-2017 at 11:30 PM.
    0.1 : Albino Clown - GHI Pastave - Killer Bee Fader - Sugar Bee - Pastel het pied - Lemon Blast het puzzle

    1.0 : Banana - Mystic Potion 66% pos het pied - Pastel Lesser het puzzle - Super Pastel 66% pos het puzzle

    1.0 2012 Albino Red Tail

  12. The Following 2 Users Say Thank You to EDR For This Useful Post:

    dr del (09-08-2017),KayLynn (09-08-2017)

  13. #19
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    Thanks for the pics guys!

    Asplundii- Thank you for that information. I was planning on working with enchi and pastel already, but I will keep the other morphs you mentioned in mind.

    Albey- Nice looking calico! In your animal's pic, I notice there is some lightening of the pattern near the belly (the areas between the parts that will turn white). Almost "orange" looking. Is this due to the calico influence or the orange dream?

    MDR- Nice looking animal. I had read that sugar was a line of calico and that they tended to be nicer (higher expression) but there don't seem to be many for sale.

    Honestly, I'm still on the fence. If the hypo pastel calico I am considering was a female, then I think I'd jump on it... But with it being a male and me wanting to limit my males, I'm not sure if I will purchase it or not. If it was an hypo enchi calico, it would be a better fit, as I am wanting to introduce enchi into my future hypo project. I think the same breeder has a calico hypo female for sale, so I may inquire about her to see how high expression she is.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  14. The Following User Says Thank You to artgecko For This Useful Post:

    EDR (09-08-2017)

  15. #20
    BPnet Lifer ladywhipple02's Avatar
    Join Date
    07-26-2005
    Location
    Greensburg, Indiana
    Posts
    2,667
    Thanks
    432
    Thanked 955 Times in 400 Posts
    Images: 11

    Re: Question about calico (and other morph interactions)

    Quote Originally Posted by EDR View Post
    Hope i'm not side tracking but may i suggest sugar. I like sugar more cause they are more consistent in the middle of the amount of white that show where as calico it tends to either be high or low white. But i do like calico so go either way i guess.

    Out of my whole collection i needed some updated pics of her the most next to my albino boa who is overdo for some new pics. Can you believe i only paid $225 for her. The seller claimed he made a mistake in posting the price and honored the listed price. I'm not a genetic expert but i do believe she is a sugar.

    I'm on the sugar bus... I know it's just another "line" of calico, but it seems to express the white gene better/in higher amounts.

    I'm also a fan of the calico/sugar mixed with orange dream, and spiders, of course. I love my spiders, but when you throw in the high white sugar with some OD, I get heart palpitations.

  16. The Following User Says Thank You to ladywhipple02 For This Useful Post:

    EDR (09-08-2017)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1