Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,309

0 members and 1,309 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 18

Threaded View

  1. 08-29-2017, 07:44 AM #12
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: 2017 Candino/ Albino clutch.

    Quote Originally Posted by StillBP View Post
    You might be surprised. Candino's don't start getting their color until after a shed or two. Until then they look like nice albinos
    Not so. I just had a clutch of four hatch out from an AlbinoWoma x Candino and I could ID the Candinos straight out of the egg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Albert Clark (09-08-2017)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1