Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,515

1 members and 1,514 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
Welcome to our newest member, arushing027
Results 1 to 2 of 2

Thread: Ivory+

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There is no Butter in that animal, I had an Ivory Butter Pastel and have an Ivory Butter OD Pastel, both are/were solid white. My guess is that it is a Ivory SuperPastel, that would account for the high yellow expression.


    As far as pairing suggestions... Kind of depends on your tastes. If you like bright combos then I would suggest something with OD and/or Fire and/or Enchi. If you are more of a dark-side type then I would suggest GHI. If you are more of a pattern person, BumbleBellies and their combos could be a way to go as would BellyBlasts
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (08-18-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1