» Site Navigation
2 members and 1,848 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,703
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Paradox Vs chiemra
difference between paradox and cheirma???
-
-
A chimera happens when two embryos fuse, forming a single individual with different body areas having different genetics. A paradox is typically caused by a mutation that forms during development and thus is usually unable to be passed on to offspring (unless the mutation happens in a cell line destined to become gonads). More typically, it is a mutation that blocks or 'breaks' the expression of a morph in a particular cell that, as it divides and replicates, can create patches of non-morph coloring. This can be large singular patch, formed when the mutation occurs early in the embryo's development, or small little flecks that happen later during the development of the fetus.
-
The Following User Says Thank You to Spiritserpents For This Useful Post:
-
Paradox is herper slang for any snake having an unexpected color or pattern change in the skin. A paradox could be a chimera (2 fused embryos), the result of a mutation in one cell line, or from some other cause.
-
-
As Paul said, "paradox" is an illegitimate slang term and holds no real meaning outside of the herper circles. It applies to any animal with aberrant pigmentation or patterning effects, regardless of cause. A chimera is a very specific type of mutant that often (but not always) displays a "paradox" phenotype.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I don't think I would call things like shatter patterns and ringers paradox since they are kinda separated from that. But slang is slang so I guess it can't really be correct or wrong.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|