Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 558

0 members and 558 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,222
Posts: 2,572,819
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Results 1 to 3 of 3

Threaded View

  1. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    More correctly, those are areas of demineralization/decalcification. Nothing too particularly worrisome about them, just be careful around those areas as they are not as strong as fully-formed parts of the egg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Emily_Doughty (08-09-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1