Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,299

0 members and 1,299 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,128
Posts: 2,572,278
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Results 1 to 4 of 4

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Acid was only released by the owner of the project last year and the public information is that all of the animals he released were purchased by one individual. There are rumours that one or two other individuals may have received an animal but those are just rumours so make of them what you will. Bottom line, Acid is a high end, high dollar project and not something you are likely to stumble on to accidentally. So, unless you paid significant money for this animal then, without even seeing the picture, my inclination is to say that the animal in question is not an Acid.


    Quote Originally Posted by BPGator View Post
    I'm not familiar with Acid but I don't think they have a white belly.
    They do not. Acid belly is heavily speckled with black (last pic in the series):

    http://www.worldofballpythons.com/morphs/acid/
    Last edited by asplundii; 06-30-2017 at 08:33 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    BPGator (06-30-2017),Dezoruba (06-30-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1