Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,790

0 members and 1,790 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,695
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 1 of 2 12 LastLast
Results 1 to 10 of 12

Thread: The Red Gene

  1. #1
    BPnet Veteran AKA Dave's Avatar
    Join Date
    06-14-2015
    Location
    Holly Springs, NC
    Posts
    1,114
    Thanks
    124
    Thanked 846 Times in 461 Posts
    Images: 70

    The Red Gene

    I have the opportunity to pick up a 0.1 Red Gene, at what I believe is a very good price. I don't know much about it though and WOBP was less than helpful. I found some older thread on BP.net so I have some basic information, but they are dated. Any more info out there? Is it worth working with?

    Thanks,

    Dave
    1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied ​Maine - 1.0 Normal Tucker - 1.0 Huffman ​Lopez
    1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo ​Jaune

    0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
    0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider​ Octavia - 0.1 The Red Gene Lemons

  2. #2
    Registered User Matt850's Avatar
    Join Date
    04-13-2016
    Posts
    79
    Thanks
    49
    Thanked 37 Times in 27 Posts
    Images: 3

    Re: The Red Gene

    Quote Originally Posted by AKA Dave View Post
    I have the opportunity to pick up a 0.1 Red Gene, at what I believe is a very good price. I don't know much about it though and WOBP was less than helpful. I found some older thread on BP.net so I have some basic information, but they are dated. Any more info out there? Is it worth working with?

    Thanks,

    Dave
    I'm still new to this so maybe someone else will chime in but what I generally do is compare prices with morph market to see if it's close.

    Sent from my SAMSUNG-SM-N920A using Tapatalk
    1.0 Enchi Banana
    1.0 Clown
    0.1 GHI
    0.1 Mojave Het. Clown
    0.1 Stinger Bee
    0.1 Black Pewter
    0.1 Hypo Butter

  3. #3
    BPnet Veteran AKA Dave's Avatar
    Join Date
    06-14-2015
    Location
    Holly Springs, NC
    Posts
    1,114
    Thanks
    124
    Thanked 846 Times in 461 Posts
    Images: 70

    Re: The Red Gene

    Quote Originally Posted by Matt850 View Post
    I'm still new to this so maybe someone else will chime in but what I generally do is compare prices with morph market to see if it's close.

    Sent from my SAMSUNG-SM-N920A using Tapatalk
    I'm not worried about the price. I'm looking for more information about the gene itself

    Dave
    1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied ​Maine - 1.0 Normal Tucker - 1.0 Huffman ​Lopez
    1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo ​Jaune

    0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
    0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider​ Octavia - 0.1 The Red Gene Lemons

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There is not a lot of info out there. It originated in Ralph's collection and was pretty tightly intertwined with the Blackhead. As people have started working more with that project they have found that some of the animals produced (both BH and non) tend to have a higher degree of that sort of burnt red colour to them and that it looks to potentially be heritable in at least a dominant-type manner.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Veteran AKA Dave's Avatar
    Join Date
    06-14-2015
    Location
    Holly Springs, NC
    Posts
    1,114
    Thanks
    124
    Thanked 846 Times in 461 Posts
    Images: 70

    Re: The Red Gene

    Quote Originally Posted by asplundii View Post
    There is not a lot of info out there. It originated in Ralph's collection and was pretty tightly intertwined with the Blackhead. As people have started working more with that project they have found that some of the animals produced (both BH and non) tend to have a higher degree of that sort of burnt red colour to them and that it looks to potentially be heritable in at least a dominant-type manner.
    That's what I've found out as well. WOBP also has it listed as a Dominant gene, but no picture. As it is, I ended up purchasing the girl. She's north of 700g, so I have a while to figure all this out. From what I am told, and I have no reason to doubt, she's pure Red Gene and comes from a line of animals that their keepers have been able to isolate the genetics so there is no Blackhead involved. Is it a shot in the dark that anything earth shattering will come of this? Of course. I just couldn't pass up the opportunity though. Who knows what it'll look like with the right combo? Only time will tell I suppose. Till then I'll keep researching it and see what is out there.

    Dave
    1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied ​Maine - 1.0 Normal Tucker - 1.0 Huffman ​Lopez
    1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo ​Jaune

    0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
    0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider​ Octavia - 0.1 The Red Gene Lemons

  6. #6
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: The Red Gene

    Quote Originally Posted by AKA Dave View Post
    That's what I've found out as well. WOBP also has it listed as a Dominant gene, but no picture. As it is, I ended up purchasing the girl. She's north of 700g, so I have a while to figure all this out. From what I am told, and I have no reason to doubt, she's pure Red Gene and comes from a line of animals that their keepers have been able to isolate the genetics so there is no Blackhead involved. Is it a shot in the dark that anything earth shattering will come of this? Of course. I just couldn't pass up the opportunity though. Who knows what it'll look like with the right combo? Only time will tell I suppose. Till then I'll keep researching it and see what is out there.

    Dave
    Well keep us posted with what you find out and on her progress 😀
    Laziness is nothing more than the habit of resting before you get tired.

  7. #7
    BPnet Veteran Izzys Keeper's Avatar
    Join Date
    09-21-2009
    Posts
    525
    Thanks
    2
    Thanked 190 Times in 116 Posts

    Re: The Red Gene

    So no pics?

    Sent from my SM-G935T using Tapatalk

  8. #8
    Registered User
    Join Date
    06-05-2017
    Posts
    40
    Thanks
    39
    Thanked 9 Times in 6 Posts

    Re: The Red Gene

    I'm also pretty interested in seeing some pics.

  9. #9
    BPnet Veteran AKA Dave's Avatar
    Join Date
    06-14-2015
    Location
    Holly Springs, NC
    Posts
    1,114
    Thanks
    124
    Thanked 846 Times in 461 Posts
    Images: 70

    Re: The Red Gene

    I'm picking her up tonight. I'll post pics over the weekend.

    Dave
    1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied ​Maine - 1.0 Normal Tucker - 1.0 Huffman ​Lopez
    1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo ​Jaune

    0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
    0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider​ Octavia - 0.1 The Red Gene Lemons

  10. #10
    BPnet Veteran AKA Dave's Avatar
    Join Date
    06-14-2015
    Location
    Holly Springs, NC
    Posts
    1,114
    Thanks
    124
    Thanked 846 Times in 461 Posts
    Images: 70

    Re: The Red Gene

    She's home. I'll put the shots of her in the pictures section.

    Dave
    Last edited by AKA Dave; 06-23-2017 at 04:27 PM.
    1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied ​Maine - 1.0 Normal Tucker - 1.0 Huffman ​Lopez
    1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo ​Jaune

    0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
    0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider​ Octavia - 0.1 The Red Gene Lemons

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1