» Site Navigation
1 members and 1,827 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,706
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
The Red Gene
I have the opportunity to pick up a 0.1 Red Gene, at what I believe is a very good price. I don't know much about it though and WOBP was less than helpful. I found some older thread on BP.net so I have some basic information, but they are dated. Any more info out there? Is it worth working with?
Thanks,
Dave
1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied Maine - 1.0 Normal Tucker - 1.0 Huffman Lopez
1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo Jaune
0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider Octavia - 0.1 The Red Gene Lemons
-
-
Registered User
Re: The Red Gene
 Originally Posted by AKA Dave
I have the opportunity to pick up a 0.1 Red Gene, at what I believe is a very good price. I don't know much about it though and WOBP was less than helpful. I found some older thread on BP.net so I have some basic information, but they are dated. Any more info out there? Is it worth working with?
Thanks,
Dave
I'm still new to this so maybe someone else will chime in but what I generally do is compare prices with morph market to see if it's close.
Sent from my SAMSUNG-SM-N920A using Tapatalk
1.0 Enchi Banana
1.0 Clown
0.1 GHI
0.1 Mojave Het. Clown
0.1 Stinger Bee
0.1 Black Pewter
0.1 Hypo Butter
-
-
Re: The Red Gene
 Originally Posted by Matt850
I'm still new to this so maybe someone else will chime in but what I generally do is compare prices with morph market to see if it's close.
Sent from my SAMSUNG-SM-N920A using Tapatalk
I'm not worried about the price. I'm looking for more information about the gene itself
Dave
1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied Maine - 1.0 Normal Tucker - 1.0 Huffman Lopez
1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo Jaune
0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider Octavia - 0.1 The Red Gene Lemons
-
-
There is not a lot of info out there. It originated in Ralph's collection and was pretty tightly intertwined with the Blackhead. As people have started working more with that project they have found that some of the animals produced (both BH and non) tend to have a higher degree of that sort of burnt red colour to them and that it looks to potentially be heritable in at least a dominant-type manner.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: The Red Gene
 Originally Posted by asplundii
There is not a lot of info out there. It originated in Ralph's collection and was pretty tightly intertwined with the Blackhead. As people have started working more with that project they have found that some of the animals produced (both BH and non) tend to have a higher degree of that sort of burnt red colour to them and that it looks to potentially be heritable in at least a dominant-type manner.
That's what I've found out as well. WOBP also has it listed as a Dominant gene, but no picture. As it is, I ended up purchasing the girl. She's north of 700g, so I have a while to figure all this out. From what I am told, and I have no reason to doubt, she's pure Red Gene and comes from a line of animals that their keepers have been able to isolate the genetics so there is no Blackhead involved. Is it a shot in the dark that anything earth shattering will come of this? Of course. I just couldn't pass up the opportunity though. Who knows what it'll look like with the right combo? Only time will tell I suppose. Till then I'll keep researching it and see what is out there.
Dave
1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied Maine - 1.0 Normal Tucker - 1.0 Huffman Lopez
1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo Jaune
0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider Octavia - 0.1 The Red Gene Lemons
-
-
Re: The Red Gene
 Originally Posted by AKA Dave
That's what I've found out as well. WOBP also has it listed as a Dominant gene, but no picture. As it is, I ended up purchasing the girl. She's north of 700g, so I have a while to figure all this out. From what I am told, and I have no reason to doubt, she's pure Red Gene and comes from a line of animals that their keepers have been able to isolate the genetics so there is no Blackhead involved. Is it a shot in the dark that anything earth shattering will come of this? Of course. I just couldn't pass up the opportunity though. Who knows what it'll look like with the right combo? Only time will tell I suppose. Till then I'll keep researching it and see what is out there.
Dave
Well keep us posted with what you find out and on her progress 😀
Laziness is nothing more than the habit of resting before you get tired.
-
-
Re: The Red Gene
So no pics?
Sent from my SM-G935T using Tapatalk
-
-
Registered User
Re: The Red Gene
I'm also pretty interested in seeing some pics.
-
-
Re: The Red Gene
I'm picking her up tonight. I'll post pics over the weekend.
Dave
1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied Maine - 1.0 Normal Tucker - 1.0 Huffman Lopez
1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo Jaune
0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider Octavia - 0.1 The Red Gene Lemons
-
-
Re: The Red Gene
She's home. I'll put the shots of her in the pictures section.
Dave
Last edited by AKA Dave; 06-23-2017 at 04:27 PM.
1.0 Banana Siagi (Butters) - 1.0 GHI Chocolate Het Ghost York - 1.0 Mystic Potion Sarge - 1.0 Pied Maine - 1.0 Normal Tucker - 1.0 Huffman Lopez
1.0 Black Pastel Mojave Yellow Belly Church - 1.0 VPI Axanthic Spider Ozpin- Butter Hypo Jaune
0.1 Super Black Pastel Texas - 0.1 Humble Bee CT - 0.1 Pied Carolina - 0.1 Killer Bee Sheila - 0.1 Black Pastel Ghost Pinstripe Coco - 0.1 Pastel Yang - 0.1 Spider Nora - 0.2 Lesser Huffman Pyrrha/FILSS
0.1 Pastel Yellow Belly Sally - 0.1 Pastel Orange Ghost Kaikaina - 0.1 VPI Axanthic Cinder - 0.1 Banana Cinnamon Kimball - 0.1 Shatter Spider Octavia - 0.1 The Red Gene Lemons
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|