» Site Navigation
0 members and 1,164 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
Re: Super spider
 Originally Posted by Bcycling
Now I may pair the spider x spider/banana. I know the odds are probably like 1 in a trillion, but let's just say this weird looking spider pops out, survives, and is proved to be a super. What would the value on an animal like that even be. Seems to me it would be more of getting your name as the first to successfully produce one that really any money due to the fact that spiders really are a low $ animal. Do u think this is correct thinking?
There have been a number of people who have already hatched SuperSpiders out, all of which have died. There is neither money nor fame to be gained from it.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (06-19-2017)
-
Re: Super spider
 Originally Posted by Bcycling
Now I may pair the spider x spider/banana. I know the odds are probably like 1 in a trillion, but let's just say this weird looking spider pops out, survives, and is proved to be a super. What would the value on an animal like that even be. Seems to me it would be more of getting your name as the first to successfully produce one that really any money due to the fact that spiders really are a low $ animal. Do u think this is correct thinking?
I would lay very good money on the fact one never survives. Why waste potential clutch money on failed eggs? Why produce animals that will die? Learn about this mutation. Super spider will not survive.
-
-
To intentionally pair snakes from which the known result would be babies that hatch, suffer and die?
-
The Following User Says Thank You to DLena For This Useful Post:
-
BPnet Veteran
Educate
Never said I was going to do the pairing just trying to educate myself. Actually, by asking the question and doing research I found there to be many more issues with different pairings that I never knew about. Please understand that some people on here actually ask questions to learn rather than just jump into things. Is the pairing I was suggesting still one I might consider, to be honest I haven't decided. It all has to do with what snakes I own and what I want to produce. If I currently want to produce spider bananas my only real option is to pair my male spider banana to my female spider. Will I do it? I doubt that I will but I am still trying to learn everything I can.
-
-
BPnet Veteran
Again
My goal was never a super spider. It was spider bananas. I just wanted to know other possibilities to the clutch if I did pair them.
-
-
Re: Educate
 Originally Posted by Bcycling
Never said I was going to do the pairing just trying to educate myself. Actually, by asking the question and doing research I found there to be many more issues with different pairings that I never knew about. Please understand that some people on here actually ask questions to learn rather than just jump into things. Is the pairing I was suggesting still one I might consider, to be honest I haven't decided. It all has to do with what snakes I own and what I want to produce. If I currently want to produce spider bananas my only real option is to pair my male spider banana to my female spider. Will I do it? I doubt that I will but I am still trying to learn everything I can.
Pairings that result in known, post-hatch mortalities should be avoided. The snakes you own, if paired, will result in known, post-hatch mortalities. Yet you are undecided about breeding them.
Owning a male and female does not obligate you to pair them. Because you now know the risks to this pairing... maybe you could acquire another snake that would give you the desired outcomes without the mortalities.
-
The Following 3 Users Say Thank You to DLena For This Useful Post:
GoingPostal (06-20-2017),Kira (06-19-2017),TerrieL (06-19-2017)
-
Here's the thing. Say each female produces 8 eggs. You could pair your banana spider to the spider, statistically you get Normal, banana, 2x spider, 2x banana spider, super spider, super spider banana. Which statistically leaves you with 6 healthy snakes. A banana spider to a normal statistically gives you 2x normal, 2x banana, 2x spider, 2x banana spider.
So really you only cutting yourself out a banana and a normal doing that pairing, but if you have the possibility, it would be much better to breed the spider female to another male and breed the banana spider to another non-spider female, giving you much better odds at hitting the snakes you might want to produce.
I don't see anything unresponsible about doing the pairing, the market is flooded with sub 200 dollar animals, no harm in producing less animals if it still meets your goals
Last edited by OhhWatALoser; 06-19-2017 at 12:00 PM.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
-
BPnet Veteran
Re: Spider breeding
I disagree with this statement. From what I have read almost all of the spider/spider pairings die within the egg. Very few actually go term.
-
-
Re: Spider breeding
 Originally Posted by DLena
To intentionally pair snakes from which the known result would be babies that hatch, suffer and die?
When did super spiders start hatching?
-
-
My position is this (and it's a big bone of contention, and I'm not trying to start WW III): I will not knowingly breed snakes that will result in the deaths of the babies - in or out of the shell - or in the creation of physically deformed or neurologically impaired babies. Enough happens accidentally. I know there are beautiful spiders and spider combos and champagnes, and HGW... but I don't think, now that we are fully aware of the situation, that they should be bred just because we like how they look.
This mentality is why we have German shepards that can't walk properly because of their hips, Collies that can't see, Pugs that can only birth their babies by C-section and those babies need nasal surgery so they can breathe properly.
As breeders, creating morphs and breeds for our own pleasure, it is inherently our obligation to do right by these "man made" creatures.
And I see it in black and white, no gray. "Well it's just a little wobble." Or "But it eats, sleeps and goes to the bathroom just fine." Is fine if it's accidental. I have a baby AHS with a kink that will never be bred but wasn't bad enough to be fed off. BUT to intentionally breed knowing the bad outcome is ethically wrong for me.
-
The Following 2 Users Say Thank You to DLena For This Useful Post:
Crowfingers (06-21-2017),Kira (06-19-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|