Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 666

0 members and 666 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,084
Threads: 249,223
Posts: 2,572,823
Top Poster: JLC (31,651)
Welcome to our newest member, Graidian
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 34

Thread: Spider breeding

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Super spider

    Quote Originally Posted by Bcycling View Post
    Now I may pair the spider x spider/banana. I know the odds are probably like 1 in a trillion, but let's just say this weird looking spider pops out, survives, and is proved to be a super. What would the value on an animal like that even be. Seems to me it would be more of getting your name as the first to successfully produce one that really any money due to the fact that spiders really are a low $ animal. Do u think this is correct thinking?
    There have been a number of people who have already hatched SuperSpiders out, all of which have died. There is neither money nor fame to be gained from it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (06-19-2017)

  3. #12
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Super spider

    Quote Originally Posted by Bcycling View Post
    Now I may pair the spider x spider/banana. I know the odds are probably like 1 in a trillion, but let's just say this weird looking spider pops out, survives, and is proved to be a super. What would the value on an animal like that even be. Seems to me it would be more of getting your name as the first to successfully produce one that really any money due to the fact that spiders really are a low $ animal. Do u think this is correct thinking?
    I would lay very good money on the fact one never survives. Why waste potential clutch money on failed eggs? Why produce animals that will die? Learn about this mutation. Super spider will not survive.

  4. #13
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5
    To intentionally pair snakes from which the known result would be babies that hatch, suffer and die?

  5. The Following User Says Thank You to DLena For This Useful Post:

    Crowfingers (06-21-2017)

  6. #14
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Educate

    Never said I was going to do the pairing just trying to educate myself. Actually, by asking the question and doing research I found there to be many more issues with different pairings that I never knew about. Please understand that some people on here actually ask questions to learn rather than just jump into things. Is the pairing I was suggesting still one I might consider, to be honest I haven't decided. It all has to do with what snakes I own and what I want to produce. If I currently want to produce spider bananas my only real option is to pair my male spider banana to my female spider. Will I do it? I doubt that I will but I am still trying to learn everything I can.

  7. #15
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Again

    My goal was never a super spider. It was spider bananas. I just wanted to know other possibilities to the clutch if I did pair them.

  8. #16
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5

    Re: Educate

    Quote Originally Posted by Bcycling View Post
    Never said I was going to do the pairing just trying to educate myself. Actually, by asking the question and doing research I found there to be many more issues with different pairings that I never knew about. Please understand that some people on here actually ask questions to learn rather than just jump into things. Is the pairing I was suggesting still one I might consider, to be honest I haven't decided. It all has to do with what snakes I own and what I want to produce. If I currently want to produce spider bananas my only real option is to pair my male spider banana to my female spider. Will I do it? I doubt that I will but I am still trying to learn everything I can.
    Pairings that result in known, post-hatch mortalities should be avoided. The snakes you own, if paired, will result in known, post-hatch mortalities. Yet you are undecided about breeding them.

    Owning a male and female does not obligate you to pair them. Because you now know the risks to this pairing... maybe you could acquire another snake that would give you the desired outcomes without the mortalities.

  9. The Following 3 Users Say Thank You to DLena For This Useful Post:

    GoingPostal (06-20-2017),Kira (06-19-2017),TerrieL (06-19-2017)

  10. #17
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    Here's the thing. Say each female produces 8 eggs. You could pair your banana spider to the spider, statistically you get Normal, banana, 2x spider, 2x banana spider, super spider, super spider banana. Which statistically leaves you with 6 healthy snakes. A banana spider to a normal statistically gives you 2x normal, 2x banana, 2x spider, 2x banana spider.

    So really you only cutting yourself out a banana and a normal doing that pairing, but if you have the possibility, it would be much better to breed the spider female to another male and breed the banana spider to another non-spider female, giving you much better odds at hitting the snakes you might want to produce.

    I don't see anything unresponsible about doing the pairing, the market is flooded with sub 200 dollar animals, no harm in producing less animals if it still meets your goals
    Last edited by OhhWatALoser; 06-19-2017 at 12:00 PM.

  11. The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:

    ladywhipple02 (06-20-2017),Stewart_Reptiles (06-19-2017)

  12. #18
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Re: Spider breeding

    I disagree with this statement. From what I have read almost all of the spider/spider pairings die within the egg. Very few actually go term.

  13. #19
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider breeding

    Quote Originally Posted by DLena View Post
    To intentionally pair snakes from which the known result would be babies that hatch, suffer and die?
    When did super spiders start hatching?

  14. #20
    BPnet Veteran
    Join Date
    07-31-2016
    Location
    Kenmore NY USA
    Posts
    928
    Thanks
    434
    Thanked 380 Times in 273 Posts
    Images: 5
    My position is this (and it's a big bone of contention, and I'm not trying to start WW III): I will not knowingly breed snakes that will result in the deaths of the babies - in or out of the shell - or in the creation of physically deformed or neurologically impaired babies. Enough happens accidentally. I know there are beautiful spiders and spider combos and champagnes, and HGW... but I don't think, now that we are fully aware of the situation, that they should be bred just because we like how they look.
    This mentality is why we have German shepards that can't walk properly because of their hips, Collies that can't see, Pugs that can only birth their babies by C-section and those babies need nasal surgery so they can breathe properly.
    As breeders, creating morphs and breeds for our own pleasure, it is inherently our obligation to do right by these "man made" creatures.
    And I see it in black and white, no gray. "Well it's just a little wobble." Or "But it eats, sleeps and goes to the bathroom just fine." Is fine if it's accidental. I have a baby AHS with a kink that will never be bred but wasn't bad enough to be fed off. BUT to intentionally breed knowing the bad outcome is ethically wrong for me.

  15. The Following 2 Users Say Thank You to DLena For This Useful Post:

    Crowfingers (06-21-2017),Kira (06-19-2017)

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1