Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 636

0 members and 636 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Results 1 to 7 of 7

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I've heard that Calico white level parents dont effect the ofsprings white level

    Quote Originally Posted by the_rotten1 View Post
    Cinnamon, spider, and black pastel will give you low white pieds
    I believe you meant to say that Spider, Cinny and BlkPastel give you high-white Pieds


    Quote Originally Posted by the_rotten1 View Post
    I wouldn't be surprised if calico worked the same way. A lot of morphs are highly reactive to each other.
    Yeah, this is already kind of known though not really vocalized. YB, hetBluEL, Clown, and a couple others tend to decrease the visual expression of Calico/Sugar. Pastel and Enchi tend to increase expression
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    qwerty53 (06-13-2017),T_Redbull (06-18-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1