» Site Navigation
0 members and 1,829 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
How did mutations start
Might be a dumb question bit ive searched cant find the answer and it bugging me? In the wild im sure you wouldn't see all these crazy morphs we have today. Or even basic mutations would you? So how dod the mutations start does anyone know the first one?
Sent from my SM-G920W8 using Tapatalk
-
-
In the wild, almost exclusively. Ball pythons are caught in the wild and the various morphs represent unusual specimens caught in the wild, or with recessive genes some simply showed up with breeding, often through inbreeding.
Few morphs have shown up spontaneously in captivity. Check out ralph davis's website amd look at the platinum, a wild import that lead to lessers and het daddies.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
The Following User Says Thank You to Oxylepy For This Useful Post:
-
Re: How did mutations start
For ball pythons it started with albino back in the early to mid 90's i believe. Over the years they slowly started to discover more and more. Some of the earliest gene's are pastel, pied bald, spider, yellow belly, hypo, caramel albino among others. And the first combo "designer ball" python heck for any reptile species was the bumble bee back in 2001 which is spider x pastel. Every year they find albino, hypo and yellowbellies in the wild but they've only ever found one spider to date. Its crazy to think all these spider ball pythons we see today all came from just one. Also imagine if spider was never discovered. Imagine no bumble bee's no killer bee's just no bee's lol. I should mention i'm getting most of this out of the ultimate morph maker guide so if anyone disagrees with any of this info take it up with kevin mccurley at nerd lol. I do believe and trust him. He's been breeding ball pythons for a long time.
0.1 : Albino Clown - GHI Pastave - Killer Bee Fader - Sugar Bee - Pastel het pied - Lemon Blast het puzzle
1.0 : Banana - Mystic Potion 66% pos het pied - Pastel Lesser het puzzle - Super Pastel 66% pos het puzzle
1.0 2012 Albino Red Tail
-
-
Re: How did mutations start
Most single gene mutations started being imported from 1 of 3 places in Africa but mainly togo if I'm right and they all went to this place in Florida before they went to pet stores and others who bought wholesale and like Greg graziani explains in a video that's what he did and found pastels and cinnimons and many other cools morphs some didn't prove out but kept as their amazing
Sent from my SM-G920W8 using Tapatalk
-
-
Mutations are always happening, just has to happen in a way that is visual. https://en.m.wikipedia.org/wiki/Mutation_rate
Platinum was not spontaneous, it was imported as you see it. As far as we know the lesser/het daddy happened in the wild. Since then multiple lesser/butter lines have been found in the wild.
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
-
Sorry, guess I misread that, oxylepy did state platy was an import, so disregard that comment.
-
-
Re: How did mutations start
 Originally Posted by OhhWatALoser
Sorry, guess I misread that, oxylepy did state platy was an import, so disregard that comment.
I will recorrect your disregard. Oxy said the original Platty was a wild import, that is not the case. The original Platty came out of Noah's farm from animals he had bred.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Really? That is new information, and not part of Ralph's writeup at all. Any sources on that?
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Re: How did mutations start
 Originally Posted by Oxylepy
Really? That is new information, and not part of Ralph's writeup at all. Any sources on that?
Listen to some of his interviews on various podcasts, he talks about it in them.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Off topic, but does Noah have a completely monopoly on exports, or is he just the biggest?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|