Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,176

1 members and 1,175 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 22
  1. #11
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Which morphs get better with age?

    Quote Originally Posted by Deborah View Post
    Anything with Hypo, fire, YB, OD will generally age better, some enchi combos age well as well while some get very muddy depending on what the combo is.

    Sent from my SM-G900V using Tapatalk
    As always, thanks Deborah. Random side question: what does hidden gene woma do?

  2. #12
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Which morphs get better with age?

    Quote Originally Posted by craigafrechette View Post
    As always, thanks Deborah. Random side question: what does hidden gene woma do?
    I have no idea how they age on their own or in combos I don't work with those, I am busy enough with what I have lol
    Deborah Stewart


  3. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    Craiga 01453 (05-19-2017)

  4. #13
    BPnet Veteran Trisnake's Avatar
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    551
    Thanks
    378
    Thanked 290 Times in 209 Posts
    Images: 1

    Re: Which morphs get better with age?

    Quote Originally Posted by craigafrechette View Post
    As always, thanks Deborah. Random side question: what does hidden gene woma do?
    From what I've seen HGW tends to hold flaming and contrast pretty well, while the brightness of the colors fade a bit. This is just an observation of others snakes though, I don't own HGW personally though it's definitely on my list. The breeder HGW yellowbellies and HGW fires I've had the privilege of seeing in person have all been very attractive for their size/age, imo. But there is high and low quality to everything.

  5. The Following User Says Thank You to Trisnake For This Useful Post:

    Craiga 01453 (05-21-2017)

  6. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Which morphs get better with age?

    Quote Originally Posted by Deborah View Post
    Anything with ... fire, YB, OD will generally age better
    I will agree that combos with these morphs tend to age well but the single genes of each are not terribly impressive as they age. And if you can get a combo with all three of those morphs... WOW!
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Craiga 01453 (05-22-2017)

  8. #15
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Which morphs get better with age?

    Quote Originally Posted by craigafrechette View Post
    As always, thanks Deborah. Random side question: what does hidden gene woma do?
    I have an inferno female that surprises me with each shed, she looks just as good if not better than when I got her. In all fairness she is only 400 grams though so it's too early to say for sure but I have definitely seen other morphs going down hill by this size so she's off to a good start, only time will tell if she holds this pretty into adulthood. As for hgw by itself, I have no experience with it.

    Others that have held color well for me are:
    enchi pastel 900g
    killerbee 800g
    nuclear enchi 1000g
    bumble belly 1800g
    pastel desert ghost 1100g by far my favorite! After each shed she looks just as clean and bright as ever! Desert ghost is an amazing morph, in combo it will make any other morph look amazing. I can't believe more people aren't working with it. I have big plans for this girl.

    I've been very lucky with all my choices so far, I've only had a couple dull with age so far but I still have quite a few that are too young to tell but I have high hopes because most combos that are still growing out have fire, enchi and OD in the mix so I think my odds are good.

  9. The Following User Says Thank You to rufretic For This Useful Post:

    Craiga 01453 (05-22-2017)

  10. #16
    Registered User ringorock's Avatar
    Join Date
    04-23-2017
    Location
    Woodstock, GA
    Posts
    122
    Thanks
    119
    Thanked 140 Times in 48 Posts
    Normal

    So rare that it should be a morph now, right?...
    Last edited by ringorock; 05-22-2017 at 10:56 AM.

  11. The Following 2 Users Say Thank You to ringorock For This Useful Post:

    Craiga 01453 (05-22-2017),JodanOrNoDan (05-22-2017)

  12. #17
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which morphs get better with age?

    Quote Originally Posted by ringorock View Post
    Normal

    So rare that it should be a morph now, right?...
    Yup, normals pretty much stay the same. A good normal is still worth as much to me as most single gene animals. People often forget that there are two genes passed to offspring. If one of those genes is actually the "normal" version, it is just as important as the "morph".

  13. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Craiga 01453 (05-22-2017)

  14. #18
    BPnet Senior Member Lizardlicks's Avatar
    Join Date
    12-08-2014
    Location
    Spokane, WA
    Posts
    1,524
    Thanks
    814
    Thanked 1,149 Times in 657 Posts
    Leopards don't really change much as they age, just a nice dark snake with a bright pattern. GHIs too.

    I think in combos vanilla has been a sort of underrated gene, or at least I don't hear much about it very often. My pastel vanilla girl is getting close to 800g and still super bright yellow. I always think she's starting to brown out when she gets close to a shed cycle, but then as soon as she's shed BAM! Glowing bright beautiful snake.
    Last edited by Lizardlicks; 05-22-2017 at 12:04 PM.

  15. The Following User Says Thank You to Lizardlicks For This Useful Post:

    Craiga 01453 (05-22-2017)

  16. #19
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Which morphs get better with age?

    Quote Originally Posted by Lizardlicks View Post
    Leopards don't really change much as they age, just a nice dark snake with a bright pattern. GHIs too.

    I think in combos vanilla has been a sort of underrated gene, or at least I don't hear much about it very often. My pastel vanilla girl is getting close to 800g and still super bright yellow. I always think she's starting to brown out when she gets close to a shed cycle, but then as soon as she's shed BAM! Glowing bright beautiful snake.
    I've been patiently waiting to read a reply like this about vanillas. My boy Tyson is a vanilla het pied. He's just barely pushing 300 grams still, but man, he looks better with each shed. His colors seem to pop a little more with each shed and his blushing just seems to get prettier.
    But maybe I'm a bit biased?

  17. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Lizardlicks (05-22-2017)

  18. #20
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Which morphs get better with age?

    Quote Originally Posted by Deborah View Post
    I have no idea how they age on their own or in combos I don't work with those, I am busy enough with what I have lol

    I should have worded my question better. I appreciate your answer and would have asked about how they age as a follow-up question.

    But what I was curious about is the gene itself. What does hidden gene woma do to the colors/patterns of the BP? And why is it called "hidden gene" woma?

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1